ID: 1191894625

View in Genome Browser
Species Human (GRCh38)
Location X:65979028-65979050
Sequence CTGTAAACAAAAGGGCAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191894625_1191894629 7 Left 1191894625 X:65979028-65979050 CCATCCTGCCCTTTTGTTTACAG No data
Right 1191894629 X:65979058-65979080 AACCACCTGTACTCTCACTCTGG No data
1191894625_1191894630 8 Left 1191894625 X:65979028-65979050 CCATCCTGCCCTTTTGTTTACAG No data
Right 1191894630 X:65979059-65979081 ACCACCTGTACTCTCACTCTGGG No data
1191894625_1191894633 18 Left 1191894625 X:65979028-65979050 CCATCCTGCCCTTTTGTTTACAG No data
Right 1191894633 X:65979069-65979091 CTCTCACTCTGGGTAATGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191894625 Original CRISPR CTGTAAACAAAAGGGCAGGA TGG (reversed) Intergenic
No off target data available for this crispr