ID: 1191894633

View in Genome Browser
Species Human (GRCh38)
Location X:65979069-65979091
Sequence CTCTCACTCTGGGTAATGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191894628_1191894633 9 Left 1191894628 X:65979037-65979059 CCTTTTGTTTACAGCTCTGAAAA No data
Right 1191894633 X:65979069-65979091 CTCTCACTCTGGGTAATGAGTGG No data
1191894625_1191894633 18 Left 1191894625 X:65979028-65979050 CCATCCTGCCCTTTTGTTTACAG No data
Right 1191894633 X:65979069-65979091 CTCTCACTCTGGGTAATGAGTGG No data
1191894627_1191894633 10 Left 1191894627 X:65979036-65979058 CCCTTTTGTTTACAGCTCTGAAA No data
Right 1191894633 X:65979069-65979091 CTCTCACTCTGGGTAATGAGTGG No data
1191894626_1191894633 14 Left 1191894626 X:65979032-65979054 CCTGCCCTTTTGTTTACAGCTCT No data
Right 1191894633 X:65979069-65979091 CTCTCACTCTGGGTAATGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191894633 Original CRISPR CTCTCACTCTGGGTAATGAG TGG Intergenic
No off target data available for this crispr