ID: 1191894763

View in Genome Browser
Species Human (GRCh38)
Location X:65980352-65980374
Sequence TTCCATCTGAGTCTCCGTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191894763_1191894766 -1 Left 1191894763 X:65980352-65980374 CCTACACGGAGACTCAGATGGAA No data
Right 1191894766 X:65980374-65980396 AGCTCATCTGGGTACCAGACAGG No data
1191894763_1191894767 0 Left 1191894763 X:65980352-65980374 CCTACACGGAGACTCAGATGGAA No data
Right 1191894767 X:65980375-65980397 GCTCATCTGGGTACCAGACAGGG No data
1191894763_1191894770 30 Left 1191894763 X:65980352-65980374 CCTACACGGAGACTCAGATGGAA No data
Right 1191894770 X:65980405-65980427 AACAAAGCAGATTCAAAGAGAGG No data
1191894763_1191894768 6 Left 1191894763 X:65980352-65980374 CCTACACGGAGACTCAGATGGAA No data
Right 1191894768 X:65980381-65980403 CTGGGTACCAGACAGGGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191894763 Original CRISPR TTCCATCTGAGTCTCCGTGT AGG (reversed) Intergenic
No off target data available for this crispr