ID: 1191897293

View in Genome Browser
Species Human (GRCh38)
Location X:66006498-66006520
Sequence TCTCAAAGAAACCTTCATTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191897290_1191897293 9 Left 1191897290 X:66006466-66006488 CCAAGGGGACTCAGATTCAGGTT No data
Right 1191897293 X:66006498-66006520 TCTCAAAGAAACCTTCATTGAGG No data
1191897287_1191897293 19 Left 1191897287 X:66006456-66006478 CCTACAAATCCCAAGGGGACTCA No data
Right 1191897293 X:66006498-66006520 TCTCAAAGAAACCTTCATTGAGG No data
1191897289_1191897293 10 Left 1191897289 X:66006465-66006487 CCCAAGGGGACTCAGATTCAGGT No data
Right 1191897293 X:66006498-66006520 TCTCAAAGAAACCTTCATTGAGG No data
1191897286_1191897293 20 Left 1191897286 X:66006455-66006477 CCCTACAAATCCCAAGGGGACTC No data
Right 1191897293 X:66006498-66006520 TCTCAAAGAAACCTTCATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191897293 Original CRISPR TCTCAAAGAAACCTTCATTG AGG Intergenic
No off target data available for this crispr