ID: 1191899173

View in Genome Browser
Species Human (GRCh38)
Location X:66023185-66023207
Sequence GGACTCTCTGGGGATCCTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 170}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191899173_1191899184 19 Left 1191899173 X:66023185-66023207 CCCCAAGGATCCCCAGAGAGTCC 0: 1
1: 0
2: 2
3: 12
4: 170
Right 1191899184 X:66023227-66023249 CAGGCCACATACCAGGAAGAAGG 0: 1
1: 0
2: 1
3: 33
4: 274
1191899173_1191899187 25 Left 1191899173 X:66023185-66023207 CCCCAAGGATCCCCAGAGAGTCC 0: 1
1: 0
2: 2
3: 12
4: 170
Right 1191899187 X:66023233-66023255 ACATACCAGGAAGAAGGGACTGG 0: 1
1: 0
2: 2
3: 17
4: 361
1191899173_1191899185 20 Left 1191899173 X:66023185-66023207 CCCCAAGGATCCCCAGAGAGTCC 0: 1
1: 0
2: 2
3: 12
4: 170
Right 1191899185 X:66023228-66023250 AGGCCACATACCAGGAAGAAGGG 0: 1
1: 0
2: 1
3: 40
4: 279
1191899173_1191899182 0 Left 1191899173 X:66023185-66023207 CCCCAAGGATCCCCAGAGAGTCC 0: 1
1: 0
2: 2
3: 12
4: 170
Right 1191899182 X:66023208-66023230 TTGTGGGAAACTTGACTGTCAGG 0: 1
1: 0
2: 2
3: 7
4: 97
1191899173_1191899183 12 Left 1191899173 X:66023185-66023207 CCCCAAGGATCCCCAGAGAGTCC 0: 1
1: 0
2: 2
3: 12
4: 170
Right 1191899183 X:66023220-66023242 TGACTGTCAGGCCACATACCAGG 0: 1
1: 0
2: 1
3: 8
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191899173 Original CRISPR GGACTCTCTGGGGATCCTTG GGG (reversed) Intronic
900116969 1:1033119-1033141 GGACTCCCTGCGGGTCCGTGGGG - Intronic
901119424 1:6878669-6878691 CAAATCGCTGGGGATCCTTGGGG - Intronic
901640282 1:10689549-10689571 GGTCTCTCTAGGGAGCCTTTCGG + Intronic
901821399 1:11832384-11832406 GGACTCTCTGGAAAGCCTTCAGG + Intronic
902812245 1:18894973-18894995 GGCCTCTCTGAGGATCCATGAGG + Intronic
903104094 1:21059923-21059945 GGACCCTATGTGAATCCTTGAGG + Intronic
907869555 1:58430990-58431012 CTATTCTCTGGGGATCCCTGAGG + Intronic
908823874 1:68115160-68115182 GGTCCCTCTGGGGCTCCTTAGGG + Intronic
909490355 1:76219521-76219543 GGAGTCTGAGGGGGTCCTTGAGG + Intronic
910215312 1:84838152-84838174 GGACAAGCAGGGGATCCTTGCGG + Intronic
913135039 1:115880164-115880186 GGACTCTCTGGGGAGCCAGGAGG - Intergenic
913447168 1:118961779-118961801 GGACTCTCTGGTGAGCTCTGAGG + Intronic
915142543 1:153776348-153776370 CGACTCCTTGGGGATCCTTGGGG - Intronic
916362237 1:163983629-163983651 GGAGTTTCTGAGGATCCCTGAGG - Intergenic
918136540 1:181679319-181679341 TTACTAACTGGGGATCCTTGGGG - Intronic
920058169 1:203207761-203207783 GGATCCTCTGGAGATCCCTGGGG + Intergenic
922798025 1:228351160-228351182 GGGCTCTCTGAGGACCCCTGGGG + Intronic
923715693 1:236423105-236423127 GAAATCTCTGGGGGTCCTAGTGG + Intronic
924477626 1:244395566-244395588 GGAGTCAGTGGAGATCCTTGGGG - Intergenic
924784863 1:247185246-247185268 GGGCTCTCTGGGGAGCCTGGAGG + Intergenic
1063487360 10:6432518-6432540 GGACTCTCTAGGGAAACTTGGGG + Intronic
1067048464 10:42999056-42999078 GGACTCTCCAGGGAGCCCTGGGG + Intergenic
1067730362 10:48806135-48806157 GGCCTCTCAGGGGTTCCGTGAGG - Intronic
1069097723 10:64280021-64280043 GCTCTCTCTTGGGATCATTGGGG + Intergenic
1069848281 10:71388123-71388145 AGACCCTCTGGGGACCATTGTGG + Intergenic
1069863664 10:71486885-71486907 CGACCCTCTGGGGAGCCCTGGGG + Intronic
1072548337 10:96457572-96457594 GGGCTCTCAGGGGATTCTTAAGG + Intronic
1073234503 10:102002366-102002388 AAACTCTTTGGGGATACTTGGGG - Intronic
1076237848 10:128879641-128879663 GGACACTCTAGGGGTCCATGGGG + Intergenic
1076619829 10:131780029-131780051 GGCCTCCCTGGACATCCTTGTGG - Intergenic
1076655991 10:132023756-132023778 CGCCTCCTTGGGGATCCTTGAGG - Intergenic
1077303019 11:1855800-1855822 GGACTCTCTGGTGACGCTGGGGG + Intronic
1078171704 11:8933243-8933265 GGAGTCTCCTGGGATCCGTGAGG - Intergenic
1079503795 11:21132272-21132294 GGATTGTCACGGGATCCTTGGGG + Intronic
1081775674 11:45674624-45674646 GGACTCTCTGTGGACTCTGGTGG + Intergenic
1083737553 11:64690374-64690396 GGGCTCTCTGGGGACCATGGGGG + Intronic
1083864532 11:65446334-65446356 GGGCTCCCTGGAGAGCCTTGTGG - Intergenic
1086084609 11:82942350-82942372 GTACTCTTATGGGATCCTTGGGG + Intronic
1087848525 11:103000990-103001012 GGACTCTCTGAAGAGCCCTGAGG - Intergenic
1088834904 11:113569249-113569271 GGACACTCTGTGGGTCCTTGGGG - Intergenic
1089560933 11:119342772-119342794 GGACACTCTGGGGGTACTGGGGG - Intronic
1089682978 11:120129778-120129800 GGACTCTCTGGGAAGCTCTGTGG - Intronic
1095060961 12:37687586-37687608 TCACACTCTGGGGACCCTTGTGG + Intergenic
1096793688 12:54060876-54060898 GGACCCTCTCAGGATCTTTGTGG + Intergenic
1096910657 12:54980573-54980595 GGCCTGTCTGGGGAGTCTTGAGG + Intronic
1096966006 12:55628286-55628308 GGACTTTCTCTGAATCCTTGGGG + Intergenic
1101068897 12:101052243-101052265 GGGCTCCCTCGGGATCCCTGAGG + Intronic
1101947522 12:109149338-109149360 GGACACTCTGAGGTTCTTTGTGG + Intronic
1103258348 12:119562855-119562877 GGCATTTCTGGGGGTCCTTGAGG - Intergenic
1103761732 12:123254981-123255003 GGACTCTCTCGTGATCCCTGAGG - Intronic
1106464619 13:30001950-30001972 GGACTCTCTGCAGAGTCTTGAGG + Intergenic
1108180304 13:47834016-47834038 AGCCTCTCTGGTGATCCTGGTGG - Intergenic
1117737289 14:58780734-58780756 GGAGCCTCTGCGGATCCATGAGG + Intergenic
1118535953 14:66764353-66764375 GTCCTCCCTGGGTATCCTTGAGG - Intronic
1119123008 14:72097503-72097525 GGAATCTCTGGAGATCCCTAAGG - Intronic
1119257004 14:73207626-73207648 AGACTCTCACGGGATCCTTAGGG + Intronic
1121839690 14:97122742-97122764 GGACTCTCTGGAGCTCCTTGAGG + Intergenic
1122075050 14:99230555-99230577 AGGGTCTCTGGGAATCCTTGGGG - Intronic
1122932752 14:104942244-104942266 CGTCTATCTGGGGACCCTTGAGG + Exonic
1124124495 15:26926580-26926602 GGACCCTCTGAAGATCCCTGAGG + Intronic
1124234910 15:27981777-27981799 GGACCCTCTGAGGATCTCTGTGG + Intronic
1125889594 15:43255644-43255666 GGAAACCCTGGGGATCCTCGTGG - Intronic
1128086256 15:64888652-64888674 GGAGACTCTGGGGCTCCCTGAGG - Intronic
1129032675 15:72629927-72629949 GGACTCTCTGGGGACAATGGGGG + Intergenic
1129407454 15:75328748-75328770 GGACTCTCTGGGGACAATGGGGG + Intergenic
1129470625 15:75751538-75751560 GGACTCTCTGGGGACAATGGGGG + Intergenic
1129841223 15:78744394-78744416 GGACTCTCTGGGGACAATGGGGG + Intergenic
1130938331 15:88488463-88488485 GGACACACAGGGGATCCTGGTGG + Intergenic
1132214744 15:100054257-100054279 GCTCTCCCTGGGGATCCTAGGGG - Intronic
1136355765 16:29744252-29744274 GGGATCTCTGGGGAACCCTGGGG + Exonic
1138924972 16:61580556-61580578 GCACTGTCATGGGATCCTTGGGG + Intergenic
1141678461 16:85530098-85530120 GGACTGTCTGGAAATCCGTGAGG + Intergenic
1141810746 16:86373765-86373787 GGTCTCTCTGGGGAGCCCTTCGG + Intergenic
1142130911 16:88431064-88431086 GGACCTGCAGGGGATCCTTGGGG - Exonic
1142401634 16:89861804-89861826 GGCCTCTCTCGGGCTGCTTGGGG + Intronic
1142567454 17:849909-849931 GGTCGCTCTCGGGCTCCTTGGGG - Intronic
1146695350 17:34904928-34904950 GGACTCTCTGGAGGCCCCTGGGG - Intergenic
1150693476 17:67384304-67384326 AAACTCTCTGGGGACCCTGGGGG - Intronic
1153073386 18:1132646-1132668 GGTCTCTCTGGTTATCCTGGGGG + Intergenic
1155059208 18:22213584-22213606 GGCCTCTCTGAGGGTTCTTGGGG + Intergenic
1158194142 18:54866232-54866254 TGACTCTCAGGGGATCCTGGTGG + Intronic
1160657188 19:279583-279605 GGACCCTCTGGGGATGGCTGTGG + Intergenic
1161014391 19:1976488-1976510 GGAATCGCTGGGGCTCCTTCTGG - Intronic
1161517671 19:4705532-4705554 TGGCTCTCTGGGGATAGTTGAGG - Intronic
1162811980 19:13169840-13169862 TGACTCTCTGGACATCCCTGGGG + Intergenic
1163371442 19:16903463-16903485 GAACCCTCTGGGGGTCCCTGGGG + Intronic
1164786616 19:30936083-30936105 GCACAATCTGGGGATCCTTTGGG + Intergenic
1164876779 19:31696436-31696458 GGACTCTCTGCAGAGTCTTGAGG + Intergenic
1165450539 19:35879610-35879632 GGACTATCTGGGAATTCTTAGGG - Exonic
1166295876 19:41889110-41889132 GGACTCTCTGTGGCTCCGCGGGG - Intronic
1167425271 19:49426962-49426984 AGAATCTCTGGGGATTCTTGGGG - Exonic
1167586673 19:50379198-50379220 GCTATCTCTGGGGTTCCTTGTGG - Intronic
1168213647 19:54909577-54909599 TCACTCTCTGGGGATCCCTCAGG - Intronic
1168311568 19:55463495-55463517 GGATTCTCAGGGGATCCCCGAGG - Intergenic
1168540379 19:57204821-57204843 GGACTTTCTGGGTAGCGTTGTGG + Intronic
1168605305 19:57754300-57754322 GAACTCTCTGGTGTTCCTTTAGG - Exonic
1168719562 19:58547497-58547519 GGACTCACTGGTGGTCCTTGTGG - Exonic
927422550 2:22948444-22948466 AGATTCTCTGTAGATCCTTGAGG - Intergenic
928393096 2:30924248-30924270 GGACTCCTTGGGGATGCTGGAGG + Exonic
929091814 2:38224896-38224918 GGACCTGCTGGAGATCCTTGAGG - Intergenic
930955282 2:57196320-57196342 GGACTGTCTGTGAAGCCTTGCGG - Intergenic
931992162 2:67801660-67801682 GAACTCTAAGGGGATCCTGGTGG - Intergenic
935359193 2:102233221-102233243 AGACTCTCTGTGGTTCCATGGGG - Intronic
940029143 2:149241934-149241956 GGACTCAGTGGGGATGGTTGGGG + Intergenic
940157729 2:150677044-150677066 TGACTCTCTGTGGAACCGTGAGG - Intergenic
945518173 2:210789083-210789105 GGATTCTCTAGGAAGCCTTGAGG - Intergenic
948584675 2:239011885-239011907 GTACTCTCTAGGGTTCCTTAGGG + Intergenic
1170568456 20:17619823-17619845 GGCCTCTCGGGAGATCCCTGAGG + Intronic
1171111078 20:22483039-22483061 GGAATCCCTGGGGATACTTCAGG + Intergenic
1173555456 20:43962309-43962331 GGACTCACTGGTGGTCCTGGGGG + Intronic
1174290605 20:49505830-49505852 CGTCTCTCTGGGAATCCTGGGGG + Exonic
1176091666 20:63321085-63321107 GGACTCACTGGGGGTCCTTGAGG - Exonic
1180079023 21:45477906-45477928 GGAGGCCCTGGGGGTCCTTGTGG - Exonic
1184239166 22:43202852-43202874 GGCCGCTCTGAGGCTCCTTGTGG + Exonic
949332539 3:2938181-2938203 TGAGGCTTTGGGGATCCTTGGGG + Intronic
951207331 3:19938729-19938751 GTTCTCTCTGGCGATCCTTGGGG - Intronic
955291615 3:57697423-57697445 GGACTCCCTGTGGGTCCTTTTGG - Intergenic
958270318 3:91491432-91491454 GGACTCTCTGAAGAGTCTTGAGG - Intergenic
959846756 3:111041531-111041553 GGACTCACAGGGGGTCCATGTGG - Intergenic
963642955 3:147880957-147880979 GGACTATCTTGGAATCCCTGAGG + Intergenic
963852825 3:150225039-150225061 GGAGTCTCTGGGGAGGATTGGGG - Intergenic
964491593 3:157241979-157242001 GAACTCTCTTGGGATCCTCAGGG + Intergenic
968453444 4:685888-685910 GAACCCTCTGGGCGTCCTTGTGG - Exonic
968704881 4:2073191-2073213 GGGCACTCAGGGGCTCCTTGTGG - Intronic
972232890 4:37096080-37096102 GAACTCTCTGAGGCTGCTTGAGG - Intergenic
974640453 4:64623871-64623893 GGACTGTCTGGCATTCCTTGAGG + Intergenic
978648951 4:110976646-110976668 GGATCCTCTTGGGATCCATGTGG - Intergenic
978981684 4:114955214-114955236 GGAAGCTCAGGGGAACCTTGGGG + Intronic
979527643 4:121734247-121734269 GGACTCTCTGCAGAGTCTTGAGG - Intergenic
980326950 4:131358230-131358252 GGACACTCTGGGGACTGTTGTGG + Intergenic
983566742 4:169161067-169161089 GTAAGCTCTGTGGATCCTTGGGG - Intronic
985512545 5:320882-320904 GTACCCTCAGGGGATCCCTGGGG - Intronic
989200813 5:38761245-38761267 GGGCTCTCTGGAGCTCCTGGAGG - Intergenic
993259037 5:85634724-85634746 GGACTCTCTGGGGCATCCTGGGG + Intergenic
995547992 5:113252033-113252055 GGACTCTCTGTTGATTTTTGTGG - Intronic
997596016 5:135107944-135107966 GGCCTCTCTGGCCACCCTTGAGG + Intronic
998527997 5:142860071-142860093 GGGCGCACTGGGGCTCCTTGTGG - Intronic
1000935459 5:167300275-167300297 GGACTGTCTGTGAAGCCTTGCGG + Intronic
1005621549 6:27625115-27625137 TGACTTTCTGGGCATCTTTGTGG + Intergenic
1006113418 6:31762515-31762537 GGACTCTCAGAGGATGCTGGTGG - Exonic
1007713446 6:43839108-43839130 GGGATCTCTGGGGTTCCCTGAGG - Intergenic
1008984831 6:57529923-57529945 GGACTCTCTGAAGAGTCTTGAGG + Intronic
1009172878 6:60422867-60422889 GGACTCTCTGAAGAGTCTTGAGG + Intergenic
1010083735 6:71891594-71891616 GGAAAATCTGGGGAACCTTGAGG + Intronic
1010189378 6:73179281-73179303 GGACTCTCTGTGGCACCCTGAGG + Intronic
1012807026 6:103907980-103908002 AGAATCTCTGGGCATGCTTGAGG - Intergenic
1012837530 6:104288864-104288886 GGACTCTGAGGTGATCCTTCAGG + Intergenic
1013177856 6:107692702-107692724 GGACTCACTGGGGCTCTGTGGGG - Intergenic
1022131847 7:27411894-27411916 GGACTCTCTGGAGGGCTTTGAGG - Intergenic
1022829198 7:34047699-34047721 AGAATCTCCAGGGATCCTTGAGG + Intronic
1022885949 7:34643844-34643866 GGACTATCTGGGGACATTTGAGG - Intergenic
1023888034 7:44374804-44374826 ATACTGCCTGGGGATCCTTGGGG + Intergenic
1029581584 7:101439921-101439943 GGACTCTGCAGGGAGCCTTGAGG + Intronic
1030221737 7:107105632-107105654 GGGAGCTCTGGGGAACCTTGGGG + Intronic
1031624713 7:123978923-123978945 GGACTTTCTGGGAGACCTTGAGG - Intergenic
1036435159 8:8726127-8726149 GGACTCTCTGGGAAGCCTCTAGG - Intergenic
1038894362 8:31764900-31764922 TCACACTCTGGGGACCCTTGTGG - Intronic
1040559756 8:48514157-48514179 CCACTCTCTGGGGCTCCTTCTGG + Intergenic
1041361484 8:57059167-57059189 GGACTCTCTGCAGAGTCTTGAGG + Intergenic
1043299684 8:78711821-78711843 GAACTCTCTGAGGATTCTTTTGG + Intronic
1048933020 8:139331021-139331043 GGACTCTCTGAGGTGTCTTGAGG + Intergenic
1049277093 8:141725321-141725343 GGACCCTCCAGGGATCCTTCAGG + Intergenic
1049535780 8:143181093-143181115 GGGATCTGTGGGGATCCGTGGGG - Intergenic
1050896261 9:10888131-10888153 GGACTGTCTGTGAAGCCTTGAGG - Intergenic
1052318135 9:27137876-27137898 GGTCTCACTGTGGACCCTTGCGG + Intronic
1053469776 9:38337983-38338005 GGCCTCTCTGGGGTTCCTGATGG - Intergenic
1055129188 9:72754656-72754678 GGACTCTTTGGGTCTCCATGTGG - Intronic
1058545608 9:106058422-106058444 GTACTATCACGGGATCCTTGGGG + Intergenic
1059319228 9:113454964-113454986 GGACTCTCTGGAGACCTCTGGGG + Intronic
1060279169 9:122204553-122204575 GGACTCTGTGGTGCTCCTGGTGG + Exonic
1060656854 9:125377965-125377987 GGGCTGTCTGGGGAACCCTGGGG - Intergenic
1060828428 9:126699478-126699500 GGACTCTCTGAGGTCCCTTCTGG - Exonic
1061031692 9:128088377-128088399 TGACTCCCTGGGGACCCTTGGGG + Intronic
1062631467 9:137464959-137464981 GGGCTCTCTTGGGTTCCTTCTGG + Intronic
1186103489 X:6181576-6181598 GGACTCTCTGCTGATTCCTGAGG + Intronic
1188108752 X:26172780-26172802 GGACTTTCTGGGGACCCATAAGG - Intergenic
1189212960 X:39300292-39300314 GGACTCTCTGAGGCACCATGTGG + Intergenic
1189386202 X:40539014-40539036 AGAGTCTCAGGGGATCCTGGTGG - Intergenic
1191899173 X:66023185-66023207 GGACTCTCTGGGGATCCTTGGGG - Intronic
1192112947 X:68383722-68383744 GAGCTCTCTGGGGATCCCTAGGG - Intronic
1192163660 X:68808890-68808912 GGCCTCTCTGGGATTCTTTGGGG + Intergenic
1192999907 X:76552624-76552646 GGACTATCTGGAAATCCCTGAGG + Intergenic
1193590537 X:83384100-83384122 GGACTCCCTGGGCTTTCTTGGGG - Intergenic
1196948417 X:120851123-120851145 AGACTCTCAGGGGATCATGGCGG - Intergenic
1201473360 Y:14356900-14356922 GGACTGTCTGTGAAGCCTTGTGG + Intergenic