ID: 1191899532

View in Genome Browser
Species Human (GRCh38)
Location X:66026504-66026526
Sequence ATGTTCTTCTCGGAGAGGAA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 135}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191899525_1191899532 21 Left 1191899525 X:66026460-66026482 CCAACTCCCTATGAGGCAATTTC 0: 1
1: 0
2: 0
3: 7
4: 124
Right 1191899532 X:66026504-66026526 ATGTTCTTCTCGGAGAGGAACGG 0: 1
1: 0
2: 0
3: 13
4: 135
1191899527_1191899532 14 Left 1191899527 X:66026467-66026489 CCTATGAGGCAATTTCTAACTTC 0: 1
1: 0
2: 1
3: 12
4: 179
Right 1191899532 X:66026504-66026526 ATGTTCTTCTCGGAGAGGAACGG 0: 1
1: 0
2: 0
3: 13
4: 135
1191899524_1191899532 26 Left 1191899524 X:66026455-66026477 CCAAACCAACTCCCTATGAGGCA 0: 1
1: 0
2: 1
3: 6
4: 176
Right 1191899532 X:66026504-66026526 ATGTTCTTCTCGGAGAGGAACGG 0: 1
1: 0
2: 0
3: 13
4: 135
1191899526_1191899532 15 Left 1191899526 X:66026466-66026488 CCCTATGAGGCAATTTCTAACTT 0: 1
1: 0
2: 1
3: 21
4: 199
Right 1191899532 X:66026504-66026526 ATGTTCTTCTCGGAGAGGAACGG 0: 1
1: 0
2: 0
3: 13
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191899532 Original CRISPR ATGTTCTTCTCGGAGAGGAA CGG Intronic
901764747 1:11492592-11492614 ATTTTCTTTGCAGAGAGGAATGG + Intronic
904839078 1:33359445-33359467 ATGTGCCTGTGGGAGAGGAATGG + Intronic
905287798 1:36894838-36894860 ATGTGCTTCTGGCAGTGGAAGGG + Intronic
905580990 1:39082324-39082346 ATGGGCGTCTTGGAGAGGAATGG + Intronic
908794815 1:67820521-67820543 ATGGGCTTCTGGGAGTGGAAGGG - Intronic
909264707 1:73541894-73541916 ATGTAATTTTCGGATAGGAAAGG - Intergenic
911238731 1:95440823-95440845 AGGTTCTCATCAGAGAGGAAAGG - Intergenic
922169650 1:223143733-223143755 CTGTTCTTATAGGACAGGAAGGG - Intergenic
924082465 1:240413338-240413360 ATATACTTATCGGTGAGGAAGGG + Intronic
924508268 1:244706383-244706405 ATGTGCTACTCAGAGTGGAAGGG - Exonic
924573175 1:245256612-245256634 ATGCCCTTCGCGGAGAGGAGAGG - Intronic
1063293869 10:4781772-4781794 ATGTTCCTCACGGATAGGAAAGG - Intergenic
1064099176 10:12448777-12448799 ATGTTTTTCACCGGGAGGAATGG - Intronic
1067331528 10:45326230-45326252 ATGTTGTTTTTGGAGGGGAATGG - Intergenic
1067919473 10:50438702-50438724 ATGTCCTTCTGAGAGAGGAGAGG + Intronic
1068598944 10:58935353-58935375 TTGTTCTCATGGGAGAGGAAAGG - Intergenic
1069417128 10:68210416-68210438 ATGCTCTTCTCGGAGTGTAGTGG + Exonic
1070481127 10:76883810-76883832 ATGTTCTACTGAAAGAGGAAGGG + Intronic
1071191485 10:83106842-83106864 TTGCTCTTCTCGGAAAAGAATGG + Intergenic
1073903224 10:108246654-108246676 AAGTTGTTCACGGAGAGGAAGGG - Intergenic
1075308128 10:121385931-121385953 ATGTGTTTCTCAGAGAGGCATGG + Intergenic
1075386222 10:122057324-122057346 ATGTTGTTGTAGTAGAGGAATGG + Intronic
1076028206 10:127134731-127134753 ATGTTCTTCAGGGAGAAGAAGGG - Intronic
1076375553 10:129981442-129981464 ATGCTGTTCTGGCAGAGGAAGGG - Intergenic
1078154463 11:8787197-8787219 ATTTTCTCCTCTGAGAGGACAGG + Intronic
1080196042 11:29610218-29610240 GTGTTCTTATCTGAGAGGTAAGG - Intergenic
1080901010 11:36490938-36490960 ATGTTAATCTTGGAGAGGACAGG - Intronic
1080905885 11:36544261-36544283 GTGTTCTTATCAGAGAAGAAGGG + Intronic
1087505676 11:99018360-99018382 ATTTTCTGCTTGGAGAGTAAGGG - Intergenic
1089112195 11:116065575-116065597 ATCTTCTGATCTGAGAGGAAAGG + Intergenic
1096417786 12:51428553-51428575 ATATTCTTGGCGGAGAGGAGGGG - Intronic
1096559822 12:52428145-52428167 ATTTTCTTCCAGGAGAAGAAGGG + Intronic
1096842313 12:54387114-54387136 ATCTTGTTCAAGGAGAGGAAGGG + Intronic
1097396777 12:59084887-59084909 AAGCTCTTGTCGAAGAGGAAAGG + Intergenic
1098387230 12:69932345-69932367 ATGTTGTTTTCAGAGAGGCAGGG + Intronic
1099153911 12:79150836-79150858 ATTTTCTTTTCAGAGAAGAAAGG + Intronic
1100146204 12:91680811-91680833 ATACTCTTCTCTCAGAGGAATGG - Intergenic
1100368143 12:93940706-93940728 ATGTACATCTCGGACAGGACTGG - Intergenic
1102847119 12:116197432-116197454 ATGTTCTTCTGGGACACAAATGG + Intronic
1103945995 12:124526730-124526752 CTGCGCTTCTCGGAGAGGACAGG + Intronic
1105723145 13:23135623-23135645 ATGCTCTTCTTGGGGAGGAGGGG + Intergenic
1107928016 13:45282238-45282260 ATTTCCTTCTTGGAGAAGAAAGG - Intronic
1108299826 13:49061923-49061945 AGGCTCTTCTTGGAGAAGAATGG + Intronic
1108557239 13:51605813-51605835 ATGTTCTCCTTGGGGACGAATGG + Intronic
1111665842 13:91267047-91267069 ATGGGCTTCTCCTAGAGGAAGGG - Intergenic
1113384349 13:109834490-109834512 AGGTTGTTCTCGTAGAGGGAAGG - Intergenic
1115760513 14:36576338-36576360 ATGTTTTTCTGGAAGAAGAATGG + Intergenic
1119981498 14:79086822-79086844 ATGTTCTTCATGGAGATGACAGG + Intronic
1120784330 14:88517371-88517393 TTGTTCTTCTCTGAGAAGAAAGG - Intronic
1121027647 14:90628342-90628364 AAGGTCCTCTAGGAGAGGAAGGG - Intronic
1124023319 15:25943251-25943273 ATGGGCTTCTGGGAGAGGAACGG + Intergenic
1124990321 15:34666812-34666834 AATTGCTTCTCAGAGAGGAATGG + Intergenic
1127369011 15:58318848-58318870 ATGTTCTCCTCGGTGAGGAGTGG - Intronic
1131217151 15:90547704-90547726 ATCTTCTTCTCTGAGAGCGAGGG + Intronic
1134377052 16:13686804-13686826 ATGTTTTAATAGGAGAGGAAGGG - Intergenic
1135335577 16:21599068-21599090 AGGTTCTTCCCGGAGACGAATGG - Intronic
1135599984 16:23774725-23774747 ATGTTCTGCTTGGAGGAGAATGG - Intergenic
1135891285 16:26359678-26359700 CTGTTCTTCCCGGAGGGGCATGG - Intergenic
1136077093 16:27824597-27824619 ATGCTCTCCTCAGAGGGGAAGGG + Intronic
1136997102 16:35198149-35198171 TTGTTCTGCTCAGAGAGGAGAGG - Intergenic
1137009856 16:35311392-35311414 TTGTTCTACTCGGAGAGGAGAGG - Intergenic
1140211883 16:72976997-72977019 ATGTTTTTCTCTGGGATGAAGGG + Intronic
1146418883 17:32663846-32663868 ATGTTCTTCAAAGAGAAGAATGG - Intronic
1146471942 17:33131709-33131731 ATGGTCCTCTTGGAGAGGACAGG - Intronic
1147930997 17:43981156-43981178 ATGTTCTGCTCGGCCAGGCATGG - Intronic
1148009884 17:44469804-44469826 ATGTGCTTCTTGGAGCTGAATGG - Intronic
1149940849 17:60864130-60864152 ATGTTTTTCTTGGAAAGGGATGG + Intronic
1151025551 17:70672246-70672268 ATATTCCTGGCGGAGAGGAAGGG + Intergenic
1157199044 18:45643358-45643380 ATGTACCTCTAGGAGAGGGAGGG + Intronic
1157607449 18:48934750-48934772 ATGTTCTCGTGGGAGTGGAAGGG + Intronic
1158690175 18:59653178-59653200 ATGTCCTTCTTGGAGAGGGCTGG - Intronic
1166402618 19:42494753-42494775 AAGTTGTTCATGGAGAGGAAAGG + Intergenic
927871798 2:26628736-26628758 AGGTTCTTCTCTGAGAAGACAGG - Intronic
928422860 2:31153129-31153151 ATTTGCTTCTTGGTGAGGAATGG - Intronic
931859763 2:66342500-66342522 ATGTGATTCTAGGAGAGCAATGG - Intergenic
933760080 2:85666901-85666923 ATGGTCTTCCCTGAGGGGAAGGG - Intronic
937188051 2:120064911-120064933 ATGTTCTTCTGGGAAAGGTCTGG - Intronic
938578710 2:132627146-132627168 ATGTTCATCACGGAGGGGACTGG + Intronic
939186416 2:138866333-138866355 ATGTTCTTCCTTGAAAGGAATGG - Intergenic
941922347 2:170863820-170863842 ATGTACTACTTGGAGAAGAAAGG - Intergenic
947947039 2:234113672-234113694 ATGGAGTTCTAGGAGAGGAAGGG - Intergenic
948877102 2:240835410-240835432 TTGTTCTTCTAGCAGAGGAATGG - Intergenic
1169768156 20:9171557-9171579 TTGCTTTTCTCTGAGAGGAAAGG + Intronic
1169857200 20:10115810-10115832 GTGTTCTTCACTGAAAGGAAGGG - Intergenic
1170974363 20:21148627-21148649 ATGTTCTTCTGGTTGAAGAACGG + Intronic
1173655231 20:44695790-44695812 ATGTTCTTTCCTGGGAGGAAGGG - Intergenic
1174187601 20:48717761-48717783 TTCTTCTACTCAGAGAGGAAAGG + Intronic
1177279594 21:18963987-18964009 ATGTTTTTCTCTGATAGGAGAGG + Intergenic
1180001811 21:44998528-44998550 CTGTTCTCCCCGGAGAGGCAGGG - Intergenic
1180181345 21:46119924-46119946 CTGTTGTTCTCTGGGAGGAATGG - Intronic
1183643423 22:39107351-39107373 ATGTCCTTCTAGAAGAGTAAAGG - Intergenic
1184380251 22:44140865-44140887 ATCTTCATCTCGGTGAGGGATGG + Intronic
1184873215 22:47254718-47254740 ATATTCCTCTAGGAGAGCAAGGG + Intergenic
1185325246 22:50222350-50222372 ATGCTCTTCTAGGAGAGGGCTGG - Intronic
949703081 3:6781492-6781514 ATGGTCTCCAAGGAGAGGAAGGG + Intronic
949829800 3:8201672-8201694 ATGACCTTCTCAGAGAGGAGAGG - Intergenic
953666167 3:44927981-44928003 ATGGTCTTCTCAGGGAAGAACGG + Intronic
954504817 3:51059769-51059791 CTATTCTTCACAGAGAGGAAGGG - Intronic
955082762 3:55673225-55673247 GTTTTCTTCTCAGAGAGGAAGGG - Intronic
955624129 3:60898669-60898691 ATGTTCTTCTCTGAGTGAAATGG - Intronic
956626720 3:71273933-71273955 ATGCTCTTCTCAGACTGGAATGG + Intronic
957517095 3:81269305-81269327 ATTTTCTTCTGGCAGATGAATGG - Intergenic
960367124 3:116786166-116786188 ATGTTCTTCAAAGAGAAGAATGG + Intronic
960758300 3:121044262-121044284 ATTTTAGTCTCAGAGAGGAATGG - Intronic
962441118 3:135417036-135417058 AAGTCCTTCTCAGAGAGGGAAGG - Intergenic
962504406 3:136031197-136031219 AGGTTCTTCTTGGAGGGGTAAGG + Intronic
964535595 3:157717664-157717686 GTGTTCCTCTCAGGGAGGAAAGG + Intergenic
971054231 4:22894827-22894849 ATATTCTAGTGGGAGAGGAATGG + Intergenic
975716492 4:77210228-77210250 AGGCTCTTCCTGGAGAGGAAAGG + Intronic
976004095 4:80407512-80407534 ATGTTCTTCTGGCAGAGGCAGGG + Intronic
978392369 4:108240707-108240729 GTGCTCTTCTAGGATAGGAAGGG + Intergenic
984687576 4:182688380-182688402 GTGCTCTTCTCTGGGAGGAAGGG - Intronic
992412194 5:76516787-76516809 ATGTGCTTCACAGAGAAGAAAGG + Intronic
993000776 5:82378678-82378700 ATATTCTTCCCACAGAGGAATGG + Intronic
997391362 5:133519784-133519806 ATCTTCTAATCGGAGAGCAAGGG + Intronic
997414489 5:133714677-133714699 ATGGTGTTCTGGGAGAGTAAAGG - Intergenic
998852331 5:146363162-146363184 ATGTTCTTCTACAAGAGGAGTGG + Intergenic
1001746697 5:174098140-174098162 ATGTTCTCCTTGCTGAGGAAAGG + Intronic
1006872583 6:37265574-37265596 AAGTTCTGCTGAGAGAGGAAGGG - Intronic
1011057028 6:83216308-83216330 ATTTGCTTCTCAGAGAAGAATGG - Intronic
1011895674 6:92221854-92221876 AAGTTATTCCCTGAGAGGAAAGG - Intergenic
1012255729 6:97029146-97029168 TGGGTCTTCTGGGAGAGGAAAGG - Intronic
1013987599 6:116214450-116214472 ATGTTCTGCTAGGAGAAAAAAGG + Intronic
1014005807 6:116416662-116416684 ATTTTCTTCTCTGACAGGACTGG + Intronic
1020158387 7:5747114-5747136 CTGTTCTTTTCAGAGAAGAAAGG - Intronic
1020265977 7:6560322-6560344 ATGTACTTCTGTTAGAGGAATGG - Intergenic
1029715525 7:102323371-102323393 CTGTTCTTGTTGGAGTGGAATGG - Intergenic
1033042133 7:137928284-137928306 ACACTCTTCTCTGAGAGGAAAGG + Exonic
1034881147 7:154763619-154763641 TTGTTTTTCTGGGTGAGGAAAGG - Intronic
1034989198 7:155537042-155537064 TTGCTCTTCTTTGAGAGGAAAGG + Intergenic
1036398017 8:8385483-8385505 ATTTTCTTCTCAGAAAGGGAAGG + Intronic
1044266515 8:90188497-90188519 ATGATTTTCTTGGAGAAGAATGG + Intergenic
1044420348 8:91988288-91988310 ATGTTCTAATTGGACAGGAATGG - Intronic
1044547263 8:93473672-93473694 ATGATATTCACTGAGAGGAATGG + Intergenic
1044643547 8:94413325-94413347 ATGTCTTTTTTGGAGAGGAAGGG - Intronic
1045223351 8:100220483-100220505 ATGTTCTTGAAGGAGGGGAAGGG - Intronic
1047596293 8:126380975-126380997 ATGTTCTTCAAGGAAAGGAAAGG - Intergenic
1048524407 8:135188066-135188088 AAGTTCTTCTGGCAGAGGAGGGG + Intergenic
1051180199 9:14403679-14403701 ATTTTCTTGTTAGAGAGGAAAGG + Intergenic
1052152036 9:25128985-25129007 ATTTTCTCCTAGGAGAGTAACGG - Intergenic
1057859511 9:98628740-98628762 ATGTTTTTCCCTAAGAGGAAGGG + Intronic
1203685986 Un_KI270757v1:60261-60283 AGGTTCTACCCTGAGAGGAATGG + Intergenic
1185591385 X:1279738-1279760 AGGTTCCTCTTGCAGAGGAACGG + Intronic
1186780368 X:12905969-12905991 ATTTTATGCTCGGAGAGCAAGGG - Intergenic
1187011876 X:15287839-15287861 ATGTGCTTATGGAAGAGGAATGG + Intronic
1187841462 X:23493385-23493407 ATCTTCTTCTGGGAGTGAAATGG - Intergenic
1190449692 X:50566121-50566143 ATGTTCTACTAGGAGGGCAAAGG + Intergenic
1191899532 X:66026504-66026526 ATGTTCTTCTCGGAGAGGAACGG + Intronic
1196844606 X:119888280-119888302 ATTTTCTTCCCGAAGAGGGAGGG + Intergenic