ID: 1191899616

View in Genome Browser
Species Human (GRCh38)
Location X:66027300-66027322
Sequence ATGGTCAAGGGCACTGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 314
Summary {0: 1, 1: 2, 2: 0, 3: 23, 4: 288}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191899616_1191899621 -5 Left 1191899616 X:66027300-66027322 CCATCCTCAGTGCCCTTGACCAT 0: 1
1: 2
2: 0
3: 23
4: 288
Right 1191899621 X:66027318-66027340 ACCATTGCTTGGCACATAGCAGG 0: 1
1: 0
2: 22
3: 143
4: 1072

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191899616 Original CRISPR ATGGTCAAGGGCACTGAGGA TGG (reversed) Intronic
900380789 1:2382837-2382859 ATGGTCAACTGCCCTGAGCAGGG + Intronic
900485287 1:2919906-2919928 GTGGTCAAGGGTGCTGGGGAGGG - Intergenic
900771988 1:4552570-4552592 ACTGTGATGGGCACTGAGGATGG + Intergenic
900972241 1:5998118-5998140 ATGGGCAAGGTCACAGAGGGAGG + Intronic
901226330 1:7614866-7614888 ATGGGCAAGGGCCCTGATGGAGG - Intronic
901686317 1:10945562-10945584 AAGAGCAAGGGCCCTGAGGAGGG - Intergenic
902940825 1:19799470-19799492 CTGGTCAAGGTCAGAGAGGAAGG - Intronic
903661165 1:24979731-24979753 ATGGGCAAAGGCTCAGAGGAGGG + Intergenic
903929791 1:26855577-26855599 ATGGCCCAGGGCCCTGAGGCTGG - Exonic
904080403 1:27869006-27869028 AGGGTCAAGGGCAGTGTGGCAGG - Intergenic
904698566 1:32344713-32344735 ATGTTCAAAGGCCCTGAGGCAGG - Intergenic
904836190 1:33338714-33338736 CTGGTCAAGGGAATTGAGTAAGG - Intronic
906059229 1:42937524-42937546 ATGGTCAAGGGCACAGACTAGGG + Intronic
906160950 1:43649035-43649057 ATTGTCAAGGGTAGTGGGGAAGG - Intergenic
906796209 1:48698177-48698199 TAGGCCATGGGCACTGAGGATGG + Intronic
907551479 1:55308690-55308712 ATGTGCAAGGGCACTGAAGCAGG - Intergenic
907601473 1:55775283-55775305 ATGCTGAAGGGCTATGAGGATGG + Intergenic
908253708 1:62285341-62285363 ATGTTCCTGGGCACTGAGGGTGG - Intronic
908331486 1:63074983-63075005 ATGGCCACGGGTATTGAGGATGG - Intergenic
909543498 1:76817340-76817362 ATAGTGAAGGACACTAAGGAGGG - Intergenic
912370244 1:109168121-109168143 ATGTTCAAATGCCCTGAGGAGGG - Intronic
913108866 1:115640637-115640659 ATGGTCTAGGCCACTGAGTGGGG + Intergenic
915404712 1:155650985-155651007 CTGGTCAAGGGCACTAAGTTGGG - Intergenic
915828136 1:159100875-159100897 AATCTAAAGGGCACTGAGGATGG + Intronic
917214429 1:172663541-172663563 ATGAACAAAGGCACAGAGGAAGG + Intronic
917455210 1:175180157-175180179 ATGGTGAAGGGCACAGAGCAGGG - Intronic
919232157 1:194787738-194787760 AGGTTTCAGGGCACTGAGGAAGG + Intergenic
919810706 1:201407252-201407274 CTGGTCCAGGCCACAGAGGATGG - Exonic
920218787 1:204380137-204380159 CTGGTCAAGGTCACTGAGAAGGG + Intergenic
920674424 1:208029415-208029437 ATGGCCACGGGCACTGTGAAGGG - Intronic
920852238 1:209635931-209635953 CTGGACAAAGGCTCTGAGGAGGG - Intronic
921359675 1:214319137-214319159 CTGCTCAAGGTCACTGAGCAAGG - Intronic
924511585 1:244732563-244732585 ATGGGCAGGGCCCCTGAGGAGGG + Intergenic
924562145 1:245165721-245165743 AGTGTCATGGGAACTGAGGAAGG + Intronic
924575518 1:245277432-245277454 AAGCCCCAGGGCACTGAGGAAGG - Intronic
1062826349 10:571554-571576 ATGGGGAAGTGCAGTGAGGAAGG - Intronic
1065781594 10:29173959-29173981 ATGGTAAGGGAAACTGAGGAAGG + Intergenic
1066269812 10:33811169-33811191 AAGGTCAGGGGCACTGAGCTGGG - Intergenic
1067808614 10:49410098-49410120 AGGGTCAAGGACAGTGAGTAAGG - Intergenic
1069258969 10:66370149-66370171 AGGTTCAAGGTCACTGAGGCTGG - Intronic
1069713101 10:70502768-70502790 GTGGGCATGGGCACTGGGGACGG - Intronic
1069833491 10:71294851-71294873 ATGCACAAGGGCTCTGAGGCTGG - Intronic
1069923597 10:71832710-71832732 AGGGTCAAGGGTACTGTGCATGG + Intronic
1070972455 10:80578805-80578827 ATGGTCAAGGCCAATGAGCAAGG + Intronic
1072841210 10:98776006-98776028 ATGGTTGTGGGGACTGAGGAGGG - Intronic
1074769449 10:116723876-116723898 ATGGTCAGGGGCCCTCAGGTGGG - Intronic
1074781311 10:116804303-116804325 ATGGTTAGGGGAACTGAGGCTGG + Intergenic
1076226000 10:128775918-128775940 TTGGTGAAGGTCACTGAGGCTGG + Intergenic
1076507236 10:130986307-130986329 TGGGTCATGGGTACTGAGGAAGG - Intergenic
1077233112 11:1467456-1467478 AGAGCCAAGGGCACTGAGCAGGG - Intergenic
1077797343 11:5506425-5506447 ATGTACAAAGGCACTGAGGTAGG - Intronic
1078066888 11:8084562-8084584 GAGGACAAGGGCACTGAGGACGG - Intronic
1079944330 11:26722817-26722839 ATGGAGAAGGCCACTGAAGAAGG - Intronic
1080132517 11:28813689-28813711 ATGGATAGGGGCAGTGAGGAGGG - Intergenic
1081852366 11:46282529-46282551 ATGTGCAAGGGCTCTGAGGCAGG - Intronic
1082817681 11:57520386-57520408 ATGGACAAGAGCACTGAGACAGG + Intergenic
1082864388 11:57885371-57885393 ATGGTAAAGGGCAGTGGAGATGG + Intergenic
1084922717 11:72484119-72484141 AGGGTGAAGGGCAGTGAGCAAGG + Intergenic
1085852790 11:80141123-80141145 GTGGTAAAGGGCTCTGAGGGTGG - Intergenic
1086942201 11:92809899-92809921 ATGGCCAAGGCCACTGACGGGGG + Exonic
1087044566 11:93833994-93834016 ATGGGCAATGGAACTGAGGCTGG - Intronic
1087341053 11:96907732-96907754 ATGGTCAAAAACAGTGAGGAAGG + Intergenic
1089049969 11:115537506-115537528 ACGGACAAGGGCCCTGAGGCAGG + Intergenic
1093487237 12:19665254-19665276 ATGGCCAAGGGCTTTGTGGAAGG + Intronic
1093842004 12:23915069-23915091 ATGATCAAGGTCACAGAGGTAGG - Intronic
1095798165 12:46243605-46243627 ATGGTCAATGGCACAGAGGCAGG + Intronic
1098102400 12:67031946-67031968 ATGGCCCAAGGCACGGAGGAGGG - Intergenic
1098230043 12:68363920-68363942 ATGTACAAGAGCCCTGAGGAGGG - Intergenic
1098688517 12:73456764-73456786 ATGGTTAAGGACTCTGAGCATGG + Intergenic
1099485016 12:83218695-83218717 ATGCTCTAGGGCTCTGAGAATGG + Intergenic
1100214747 12:92435809-92435831 AGGGCCAAGGGCACTGAGGGAGG - Intergenic
1100306135 12:93351804-93351826 ATGGGCCAGGGCACAGAGTAGGG - Intergenic
1101476219 12:105051199-105051221 AGGGTCAAGGTCACAGAGCAGGG - Intronic
1102139950 12:110606468-110606490 ATGCTCACGGGCACTTAGGATGG - Intergenic
1102462164 12:113106546-113106568 ATGTGCAAGGGCCCTGAGGTAGG - Intronic
1104370804 12:128222322-128222344 ATTGTAAAGGGAACTAAGGATGG + Intergenic
1104488822 12:129176490-129176512 TTGGCCAAGGCCACAGAGGAAGG + Intronic
1105754947 13:23455367-23455389 AAGGTCATGGGCTTTGAGGAAGG + Intergenic
1105796847 13:23863294-23863316 ATGATCGAAGGCACTGAGCAGGG + Intronic
1107010426 13:35665106-35665128 ATGGTCATGGCCTGTGAGGACGG - Exonic
1107818709 13:44267094-44267116 AGGGTCTGGGGCACTGAAGAAGG + Intergenic
1108597065 13:51958606-51958628 AGGGCCAAGGGCCCTGGGGATGG + Intronic
1110356589 13:74574569-74574591 ATGAACAAAGGCACTGAGGTAGG - Intergenic
1110551611 13:76816804-76816826 ATTGTCAAGCCCACTGAGCAGGG + Intergenic
1110894264 13:80729423-80729445 GGGGTGAAGGGCAGTGAGGAAGG + Intergenic
1113223677 13:108134866-108134888 ATTGGCAAGGGCTGTGAGGAAGG - Intergenic
1113626602 13:111852510-111852532 ATGGACTAGGGGACTGAGGAAGG + Intergenic
1113908999 13:113832994-113833016 AGGGTCAAGGGAAATGAGCAGGG - Intronic
1114009178 14:18348912-18348934 AGGGTCAGAGGCACTGAGCAGGG - Intergenic
1116761692 14:49022758-49022780 AAGGACAAGGCAACTGAGGAAGG - Intergenic
1117154952 14:52929611-52929633 ATGTACAAGGGCACTGCGGCAGG - Intronic
1117889525 14:60403901-60403923 ATGGGCAAGGGTCCTGAGGCAGG - Intronic
1118769408 14:68931880-68931902 CTCGGCAAGGGCACTGGGGAAGG + Intronic
1119080486 14:71688682-71688704 ATTGTAAATGGCACTCAGGACGG - Intronic
1119264963 14:73259171-73259193 ATGGTCCAGGGGACGGAGGAAGG + Intronic
1121607675 14:95253182-95253204 AAGGACAAAGGAACTGAGGAAGG + Intronic
1122983194 14:105200691-105200713 ATGGAGAAGGGCCCAGAGGATGG - Intergenic
1123392372 15:19889515-19889537 AGGGTCAGAGGCACTGAGCAGGG - Intergenic
1124716629 15:32069347-32069369 ATAGTCAAAGCCACTGAGGCTGG + Intronic
1127092148 15:55478065-55478087 CTGGACAGGGGCAGTGAGGAAGG - Intronic
1127141789 15:55985399-55985421 ACTGGCAAGGGTACTGAGGAGGG + Intronic
1129174633 15:73831142-73831164 ATGGTTAAGGGCACAGAGTCTGG - Intergenic
1130128039 15:81110763-81110785 ATGATCAAGGGCACTAAAAAGGG + Intronic
1130553244 15:84905330-84905352 ATGGGCCTGGGCAGTGAGGAGGG - Intronic
1132974853 16:2706140-2706162 GTGGTCCAGGGCACTGAGCCTGG + Intronic
1133128857 16:3664132-3664154 AGGGTCACGGGCACAGAGGCCGG - Exonic
1133540758 16:6751020-6751042 ATGTTCAAGGGCCCTGATGTGGG + Intronic
1133928961 16:10216682-10216704 ATGTGCAAAGGCCCTGAGGAGGG + Intergenic
1134812177 16:17177101-17177123 ATGCACAAAGGCACTGAGGCAGG - Intronic
1134814055 16:17191550-17191572 GTGGTAAAGGGCCCTGAAGAGGG + Intronic
1135758588 16:25118307-25118329 ATGCTCCAGGGCCCCGAGGATGG - Intronic
1137997606 16:53236184-53236206 ATGGGAAAGGGTACTGATGAGGG - Intronic
1138443189 16:57047251-57047273 ATGGTCAAGGTGAGTGAGGATGG + Intronic
1138482537 16:57313137-57313159 AAGGGCAAGGGCATTGAGGGAGG + Intergenic
1138591660 16:58002534-58002556 ATGTTCCCGGGCACCGAGGAGGG + Exonic
1140407641 16:74721676-74721698 GTGTTCAAGGGCAGTGGGGAGGG - Intronic
1146693110 17:34890166-34890188 ATCGTCGTGGGCACTGATGAGGG - Intergenic
1147859848 17:43512528-43512550 ATGGAAGATGGCACTGAGGAGGG + Intronic
1148456335 17:47813419-47813441 AAGGTGCAGGGTACTGAGGACGG + Intronic
1150484863 17:65536815-65536837 AGGGTCATGGGCACTCAGTACGG - Intronic
1151001237 17:70379386-70379408 ATGGTGAAGGTCATTGAGGATGG + Intergenic
1151133834 17:71925638-71925660 ATGGGCAGGGGCACTGGAGATGG - Intergenic
1151179097 17:72312763-72312785 AATGTCAATGGCACTGAGGTTGG - Intergenic
1151528141 17:74685589-74685611 TTGTTCAAGGGCACTCAGCAGGG + Intronic
1151818024 17:76481145-76481167 GTGGTCAGGGGCACACAGGAAGG - Intronic
1153058004 18:966971-966993 ATGGTCAAGTTCACTGAGTCTGG + Intergenic
1153451376 18:5233286-5233308 ATGGACCAGGCAACTGAGGATGG + Intergenic
1153501226 18:5751968-5751990 AAGGGGAAAGGCACTGAGGAAGG + Intergenic
1157197004 18:45627610-45627632 GTGGGAAGGGGCACTGAGGAAGG + Intronic
1158421624 18:57299841-57299863 ATGGACAAGGAGACTGAGGTAGG + Intergenic
1159557250 18:69958261-69958283 ATGGTCAAGGGCCCTGTGCAAGG - Intronic
1159985948 18:74841104-74841126 ATAGTAAAGGGCACTGAAGAGGG - Intronic
1160688665 19:450051-450073 ATGGCCAGGGGCACTGACGGGGG - Intronic
1161260900 19:3337221-3337243 AAGGCCAAGGGCACTGAGTCAGG + Intergenic
1161313966 19:3609276-3609298 AGGGTCACGGGCACTGAGCCTGG - Intergenic
1162322554 19:9978754-9978776 ATGGTGGAGGGAACTGGGGAAGG - Intronic
1163730805 19:18948219-18948241 ATGGGCAAAGGCCCTGAGGTGGG + Intergenic
1164446431 19:28321567-28321589 TGGCTCAAGGGCTCTGAGGAAGG - Intergenic
1165452953 19:35895860-35895882 ATGTTCAAGGGCACGCAGCAAGG + Intronic
1166996699 19:46722917-46722939 CTGGTGAAGGCCACTGAGGTGGG + Exonic
1167725934 19:51212486-51212508 ATGGCCATGGGGGCTGAGGATGG - Intergenic
1168289091 19:55348262-55348284 ATGGACTAGGGGACTGAGGCTGG + Intergenic
926076830 2:9949703-9949725 TTGGACCAGGGCACAGAGGAGGG + Intergenic
926537894 2:14136054-14136076 ATGGTCAAGTTTAGTGAGGAAGG + Intergenic
926794595 2:16608473-16608495 ATGGCCAAGTGGAATGAGGACGG + Intronic
928238166 2:29563456-29563478 ATGAGCAAGGTCACTGTGGAAGG - Intronic
930065422 2:47324080-47324102 ATGCTCAAAGGCTCTGAGGTGGG + Intergenic
930108227 2:47656668-47656690 ATGGTCAAATGCACAGAGAAGGG - Intergenic
930139391 2:47936159-47936181 ATGTTCACTGGCACAGAGGAAGG - Intergenic
931555401 2:63497961-63497983 ATGTACAAGGGCACTGAGTGGGG - Intronic
932442149 2:71744227-71744249 ATGGGCAGGGACTCTGAGGAAGG - Intergenic
935577575 2:104726711-104726733 CTTGTCATGGTCACTGAGGATGG - Intergenic
936144577 2:109971459-109971481 ATGGTCAAGGGCCTTAAGGCCGG + Intergenic
936181261 2:110269422-110269444 ATGGTCAAGGGCCTTAAGGCCGG + Intergenic
936200110 2:110400010-110400032 ATGGTCAAGGGCCTTAAGGCCGG - Intergenic
938527402 2:132146441-132146463 AGGGTCAGAGGCACTGAGCAGGG + Intergenic
938665502 2:133531155-133531177 ATGGTGAAAGGGAATGAGGAAGG + Intronic
940924748 2:159352195-159352217 AAGATCAAGGGCTCTGAGAAGGG - Intronic
941036490 2:160574545-160574567 CTGGTCATGAGAACTGAGGAGGG + Intergenic
941067455 2:160919430-160919452 ATGGGGAGGGGCCCTGAGGATGG - Intergenic
942430913 2:175910511-175910533 TTGGTCAGGGGGACAGAGGAAGG - Intergenic
945769284 2:214020208-214020230 ATGGCCAAGGGCATGGAAGAAGG - Intronic
946080921 2:217117558-217117580 ATGTTCTAGGGAACTGATGATGG + Intergenic
946541068 2:220685190-220685212 ATTGTCTAGGACACTGGGGATGG - Intergenic
947713047 2:232326650-232326672 AAGGTCAAGGGCACTGAGGAGGG - Intronic
947720113 2:232365119-232365141 AAAGTCAAGGGCAGTGAGTAGGG - Intergenic
947732730 2:232440106-232440128 AAGGTCAAGGGCACTGAGGAGGG - Intergenic
947938724 2:234029469-234029491 GAGGTCAATGGCACTCAGGAGGG - Intergenic
948654650 2:239469113-239469135 ATGGTCACTGGCAGTGATGAGGG + Intergenic
1169004706 20:2196892-2196914 ATGGAGAAGGGCATGGAGGAGGG + Intergenic
1171976135 20:31595946-31595968 AAGGGCAAGGGCCCTGAGGCAGG + Intergenic
1173903023 20:46604790-46604812 AGGGTCCAGGGCACTGAAGTAGG + Intronic
1174560570 20:51428075-51428097 AGGGTCAAGGACACAGAGGAAGG + Intronic
1176049674 20:63111349-63111371 TTTGTGAAGGCCACTGAGGATGG - Intergenic
1177087026 21:16718656-16718678 ATTGTCAAGGTCACTAAAGAGGG + Intergenic
1178365700 21:31987266-31987288 ATGGTCACCTGCACTGAGGGTGG + Intronic
1178521630 21:33292154-33292176 GTGGTCAGGGGCCCTGGGGAAGG - Intronic
1179165184 21:38929956-38929978 ATGGACTAAGGCACTGATGAAGG + Intergenic
1180433677 22:15279722-15279744 AGGGTCAGAGGCACTGAGCAGGG - Intergenic
1180516231 22:16147631-16147653 AGGGTCAGAGGCACTGAGCAGGG - Intergenic
1181082970 22:20426201-20426223 GTGGTCAAGGGCACAGGGGACGG + Exonic
1181987052 22:26807061-26807083 TTGGTGGAGGGCACTGAGCAGGG + Intergenic
1182012391 22:27011738-27011760 ATGTTCAAAGGCCCTGAGGCAGG - Intergenic
1182461990 22:30489826-30489848 ATGATCCAGTCCACTGAGGATGG - Exonic
1182840895 22:33389111-33389133 ATGGACAAAGGCACAGAGGCAGG + Intronic
1182877928 22:33708399-33708421 ATGGCGAGGGGCACTCAGGAGGG - Intronic
1183252880 22:36742851-36742873 CTGGGCAAGGGCCCTGAGGAGGG + Intergenic
1184647846 22:45905875-45905897 ATTGTCAGGGGCACAGTGGAAGG - Intergenic
1184688980 22:46108926-46108948 ATGCTCTAGGGCCCAGAGGAGGG - Intronic
949140228 3:623872-623894 ATAGGAAAGAGCACTGAGGAAGG - Intergenic
949367715 3:3301184-3301206 ACGGTCAAAGGCTCTGAGGTAGG - Intergenic
949382246 3:3459503-3459525 ATGTGCAAGGGCCCTGAGGCAGG + Intergenic
949862108 3:8515365-8515387 ATGGAGGAGGGCACTGAGGAAGG - Intronic
950422118 3:12905389-12905411 ATGGTCACTGACACTGAGCAAGG - Intronic
950545897 3:13637725-13637747 ATCATCAAGGGCAATGAGGAGGG + Exonic
952247781 3:31614408-31614430 ATGGACAAGGAAACTGGGGAGGG - Intronic
954198337 3:49009224-49009246 ATGGGCAAGAGCATTGAGTATGG - Intronic
954379352 3:50211319-50211341 TTGGTCCAGGGCAGGGAGGAGGG - Intronic
954691002 3:52395520-52395542 AGGGGCAAGAGCACTGAGCAGGG - Intronic
955880850 3:63543787-63543809 AGTGTCTAGGGCATTGAGGAAGG - Intronic
956873284 3:73439027-73439049 AGTGTGCAGGGCACTGAGGAGGG - Intronic
957334887 3:78815244-78815266 ATGATTAAGATCACTGAGGAAGG + Intronic
957716464 3:83935134-83935156 ATGCTCAAGGGCTTTGTGGAAGG + Intergenic
960529637 3:118748597-118748619 ATGAGCAAAGGCACAGAGGAAGG - Intergenic
961442158 3:126959575-126959597 ATGGTCAAGGGCCTTGGGGTGGG + Intronic
965743100 3:171897304-171897326 ATGGCCAGGGGCACCGAGGCTGG - Intronic
968984777 4:3869169-3869191 AGTGTCAAGGGCAGTGGGGAGGG + Intergenic
970402901 4:15735092-15735114 ATGTTCAAAGACCCTGAGGAGGG - Intronic
972031336 4:34462682-34462704 TTGTTCAAGGGCACAAAGGAAGG - Intergenic
972997186 4:44895353-44895375 ATGTGCAATGGCCCTGAGGAGGG + Intergenic
975012187 4:69370245-69370267 ATGGTGAAGGGGTGTGAGGATGG - Intronic
976244070 4:82990050-82990072 GTGGGCAAGGGCAGTGGGGATGG - Intronic
978088367 4:104683661-104683683 CTGGTCAAGGGCTGTGTGGAAGG + Intergenic
981593580 4:146392967-146392989 ATGATCAAGGGCCTTGAGGCAGG - Intronic
982162808 4:152586910-152586932 ATGTTCTAGGGCTCTGTGGAAGG + Intergenic
983758207 4:171369138-171369160 ATGGTTAAGTGTAGTGAGGAAGG + Intergenic
983971056 4:173874899-173874921 ATGTTCAAGGGCCCTGTGGCTGG + Intergenic
985524992 5:397195-397217 ATGGTCAGGGGCTATGTGGATGG - Intronic
985525059 5:397464-397486 ATGGTCAGGGGCTATGTGGATGG - Intronic
985525100 5:397635-397657 ATGGTCAGGGGCTATGTGGATGG - Intronic
986313743 5:6572648-6572670 GAGGTCAGGGGCAGTGAGGACGG + Intergenic
986617922 5:9638974-9638996 ATGGTCTTGGGCACTGAGCGGGG - Intronic
987555230 5:19437735-19437757 ATGAGCAAAGGCACAGAGGAAGG - Intergenic
990907775 5:60822201-60822223 ATAGTCAAATGCACTGAGAAAGG + Intronic
992110993 5:73493513-73493535 ATGGTTATGAGCACAGAGGATGG + Intergenic
992858863 5:80891720-80891742 CTGGTCAAGGGCACTAAGGTGGG - Intergenic
996769113 5:127066952-127066974 ATTGTCAAGGAGACTGATGAGGG + Intronic
997176230 5:131780908-131780930 ATGATCAAGCGTAGTGAGGAAGG + Intronic
998373465 5:141675923-141675945 AGGATTAAGGGCACAGAGGAGGG - Intronic
998726541 5:145023176-145023198 ATGGTAGAGTGCACAGAGGAAGG + Intergenic
1000286784 5:159833709-159833731 AAGAGCAAAGGCACTGAGGAAGG + Intergenic
1001121748 5:168986526-168986548 ATGGACGAGGACACTGAGAATGG - Intronic
1001400685 5:171444668-171444690 GTGGTGAAGGGCACTGACCATGG + Intronic
1001589917 5:172858200-172858222 ATGGGCAAAGGCCCTGAGGTGGG + Intronic
1001677548 5:173531160-173531182 ATGTTCAAAGGCCCTGAGGTGGG + Intergenic
1002338274 5:178495358-178495380 AAAGTCAAGGGCATAGAGGATGG + Intronic
1002856839 6:1045391-1045413 ATGGTCAAGGGTGGTGAAGAGGG + Intergenic
1003690989 6:8353558-8353580 ATGGTCAAGGTCACTGGGTGTGG + Intergenic
1006027103 6:31154169-31154191 ATTGTGGAGGGCAGTGAGGAAGG - Intronic
1006262526 6:32887162-32887184 AGGTCCAAGGGCACTGAGGGAGG - Intergenic
1006386378 6:33733355-33733377 GTGCTCAAGGGCACTGAGAGTGG + Intronic
1006510127 6:34516967-34516989 GGGGTCAAGGGCAGTGAGGAGGG - Intronic
1006640257 6:35485975-35485997 GTGGGGAAGGGGACTGAGGAGGG + Intronic
1007081098 6:39104852-39104874 ATGGTGATGGGCAATGAAGAGGG + Exonic
1007125831 6:39424867-39424889 ATGGTCAAGGACACTCAAGATGG + Intronic
1007730620 6:43943306-43943328 ATGGGCATGGGCAGTGTGGAAGG - Intergenic
1007934614 6:45721829-45721851 ATAGCTAAGGGCACTGCGGAAGG - Intergenic
1010800918 6:80174736-80174758 ATTCTATAGGGCACTGAGGATGG + Intronic
1010897238 6:81379391-81379413 ACAGGCAAGGGCACAGAGGAAGG + Intergenic
1011471765 6:87715265-87715287 ATGGTCAAGGGCACTGATTTTGG - Intergenic
1011882334 6:92045281-92045303 ATGGTAAAGGTCACTGAACAAGG - Intergenic
1012444726 6:99296314-99296336 CTTGTGAAGGGCACTGAGGGAGG + Intronic
1014729705 6:125018758-125018780 ATGGTCAAGAGAGGTGAGGAGGG - Intronic
1014783659 6:125593161-125593183 CTTGGCAAGGGCACTGAGGGTGG - Intergenic
1015382371 6:132584113-132584135 ATGGACAAAGGTTCTGAGGAAGG - Intergenic
1016886312 6:148963100-148963122 AGGGCCCAGGGCACAGAGGAGGG + Intronic
1017646224 6:156542147-156542169 GTGGTCAAGGGGGCTGGGGATGG - Intergenic
1017734692 6:157350623-157350645 ATGGTTAAGCTCAGTGAGGAAGG + Intergenic
1018152816 6:160956164-160956186 AAGGGCAAGGGCCCTGAGGCAGG + Intergenic
1020361398 7:7330358-7330380 ATGGTCAAGGACACTAATCATGG + Intergenic
1021286051 7:18782208-18782230 ATGTTCAAGGCATCTGAGGAAGG + Intronic
1021411855 7:20337945-20337967 ATGGCCAAGGACACTGATGCAGG + Intronic
1021566714 7:22023721-22023743 AGGGTCCAAGGCACGGAGGAAGG - Intergenic
1021807099 7:24368318-24368340 TTGGTCAAGGGCAATGTAGATGG - Intergenic
1022029467 7:26479160-26479182 AAGTGCAAGGGCACTGAGCAGGG - Intergenic
1022690764 7:32650531-32650553 ATGTGCAAAGGCCCTGAGGAAGG + Intergenic
1022918330 7:34984365-34984387 ATGTGCAAAGGCCCTGAGGAAGG + Intronic
1023339945 7:39209596-39209618 AAGTTCAAGGGCAATAAGGATGG + Intronic
1023528912 7:41133560-41133582 ATGGCCAAGTGCACAGAAGAAGG + Intergenic
1027258075 7:76443969-76443991 GTGGTTAAGGGCACTGAGCCAGG + Intergenic
1027280772 7:76608052-76608074 GTGGTTAAGGGCACTGAGCCAGG - Intergenic
1030633238 7:111918420-111918442 ATGGTCACGGGAAATGAAGAAGG + Intronic
1031771859 7:125853903-125853925 ACTGTCAAGGCCACTGGGGAGGG - Intergenic
1035012107 7:155728355-155728377 TGGGTGAAGGGCAGTGAGGAGGG - Intronic
1035536473 8:395070-395092 CTGGTGAAGGGGAATGAGGAAGG + Intergenic
1037638905 8:20724881-20724903 ATGGACAAAGGCCCTGAGGTAGG + Intergenic
1037735128 8:21559750-21559772 ATGTTCAAGGACTATGAGGAAGG + Intergenic
1037941647 8:22955976-22955998 ATGGAGACGGGCACTAAGGAAGG + Intronic
1039588777 8:38729277-38729299 ATGCTCAAGGGCCCTGACCAGGG - Intronic
1039827758 8:41189403-41189425 AAGCCAAAGGGCACTGAGGATGG - Intergenic
1040033758 8:42849136-42849158 ATGATCAAGTGTAGTGAGGAAGG - Intergenic
1040529962 8:48258803-48258825 ATTCTCAAGGGCACAGAGGCAGG - Intergenic
1040592106 8:48803049-48803071 GTGATCAAGGGTACTGTGGAGGG - Intergenic
1040889455 8:52301867-52301889 AGAGTCAAGGGAGCTGAGGAAGG + Intronic
1047083701 8:121493271-121493293 AAAGTCAAAGGAACTGAGGAAGG - Intergenic
1047209376 8:122828650-122828672 GTGGCCATGGGCACTGAGAAGGG + Intronic
1049224352 8:141442522-141442544 CTGGGCAAGGGCACAGAGGTGGG + Intergenic
1050248039 9:3712889-3712911 GTGGAAAGGGGCACTGAGGAGGG + Intergenic
1050360889 9:4829970-4829992 ATGGTCCAAGGGACTGAGAATGG + Intronic
1052688251 9:31780952-31780974 ATGTGCTAGGGCAATGAGGAAGG - Intergenic
1053542935 9:38993590-38993612 AGGGTGAAGTGCACTCAGGATGG + Intergenic
1053807378 9:41817107-41817129 AGGGTGAAGTGCACTCAGGATGG + Intergenic
1054623214 9:67370320-67370342 AGGGTGAAGTGCACTCAGGATGG - Intergenic
1057725867 9:97567764-97567786 GAAGTGAAGGGCACTGAGGAGGG + Intronic
1057858855 9:98624147-98624169 GTGGTCCTGGGCACTGTGGAGGG + Intronic
1057921821 9:99104528-99104550 CATGTGAAGGGCACTGAGGAGGG + Intronic
1057976763 9:99612788-99612810 AAGATCAAGGGCACTCAGGCTGG + Intergenic
1058275561 9:103037553-103037575 AAAGTCAAGGCTACTGAGGAAGG + Intergenic
1061322807 9:129841924-129841946 ATGCTCAAGGTCACTCAGAAGGG - Intronic
1062217980 9:135399414-135399436 ATGGCCAGGGGGACTGAGGTTGG + Intergenic
1186566626 X:10669944-10669966 ATATTCAAAGCCACTGAGGAAGG - Intronic
1186768371 X:12793060-12793082 ATGGTCTAGGGCTCTGGAGAAGG + Intronic
1189406178 X:40726226-40726248 AGGGTATAGGGCACAGAGGATGG - Intronic
1189425361 X:40895614-40895636 AAGGGCAAGGCCACTGAAGATGG - Intergenic
1189506581 X:41616978-41617000 ATGATCACCGGCCCTGAGGAAGG + Intronic
1190460967 X:50674901-50674923 GTGGTTAAGTGCACAGAGGACGG + Intronic
1191899616 X:66027300-66027322 ATGGTCAAGGGCACTGAGGATGG - Intronic
1192228110 X:69243289-69243311 AGGGGCAATGGCAGTGAGGAGGG - Intergenic
1192576088 X:72244423-72244445 ATGATCAAAGGCCCTGAGGCAGG + Intronic
1195956339 X:110334982-110335004 ATGGTTAAGGGCACTGACTCTGG + Intronic
1196208222 X:112965421-112965443 ATGGTCAAAGGCCCTGTGGCAGG - Intergenic
1197163874 X:123354317-123354339 ATGCCTTAGGGCACTGAGGAGGG - Intronic
1200776314 Y:7173120-7173142 ATGGTAAAGGACCTTGAGGATGG - Intergenic
1200816532 Y:7539040-7539062 AGGGTCAAGGGCGGGGAGGATGG + Intergenic