ID: 1191900487

View in Genome Browser
Species Human (GRCh38)
Location X:66035127-66035149
Sequence GTTCTAAGGGTCCCTGGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 110}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191900487 Original CRISPR GTTCTAAGGGTCCCTGGTGA GGG (reversed) Intronic
902323338 1:15683621-15683643 GGTCTCAGGGTCTCTGGGGAGGG + Intergenic
904511459 1:31012765-31012787 GTTTTAAGGGTTCTTGGTGTAGG - Intronic
905313420 1:37066121-37066143 TGTCTGAGGGGCCCTGGTGAGGG - Intergenic
906052553 1:42887327-42887349 GCTGTATGGGTTCCTGGTGATGG - Intergenic
906132836 1:43471356-43471378 CTTCTCAGGGGCCGTGGTGAGGG + Intergenic
906151601 1:43591029-43591051 GTTCCCAGAGTCCCAGGTGAGGG - Exonic
906302914 1:44696802-44696824 GAATTAAGGGTCCCTGGAGAAGG - Intronic
910443820 1:87280586-87280608 GGTCTATGGGTCCATGCTGAAGG + Intergenic
916964675 1:169924934-169924956 CTTCTCAGGGCCCCTAGTGAGGG - Intronic
919453632 1:197799395-197799417 GTTCTGAGATTCCCTGGGGATGG - Intergenic
919822827 1:201483718-201483740 GATCTAAGGGTCCCTGGAGAAGG + Exonic
920252141 1:204628914-204628936 GTTCTAAATGTCCCAGCTGATGG + Intronic
921840316 1:219821294-219821316 GTTCTCATGGTCCATGGTCATGG - Intronic
1063073679 10:2692431-2692453 GCTCACAGGGTCCCTGGTGCAGG + Intergenic
1067151199 10:43736286-43736308 GGACTAGGGGGCCCTGGTGAGGG - Intergenic
1069765868 10:70858889-70858911 GTGCTAAGGGACCCTGAAGAGGG - Intronic
1074944316 10:118266482-118266504 GTGCTAATGGACCCTAGTGAAGG + Intergenic
1077623934 11:3753342-3753364 GTTCCAAGAGTCCCAGGTGCTGG + Exonic
1081775104 11:45671213-45671235 GTACTGAAGGACCCTGGTGATGG - Intergenic
1087600132 11:100303994-100304016 GCTCTAAGGGTCTCTTGGGAAGG + Intronic
1104714785 12:131009084-131009106 GGTCGGAGGGTGCCTGGTGATGG + Intronic
1105605582 13:21923905-21923927 GTTCTGAAGGTCTGTGGTGATGG + Intergenic
1105821453 13:24084607-24084629 GTCCTGAGGGTCTCTGGTGGAGG + Intronic
1108259408 13:48641864-48641886 GTGCTAAGAGTCCCTAGTGAAGG + Intergenic
1111141690 13:84127530-84127552 GTGCTAAGGGTCACTGGGCATGG - Intergenic
1111263116 13:85769751-85769773 GTTCCAAGGGTATCTGGTGAAGG + Intergenic
1115154148 14:30319309-30319331 GTTTTAAGGAGCCCTTGTGATGG + Intergenic
1123943378 15:25227360-25227382 GGGCTCTGGGTCCCTGGTGACGG + Intergenic
1124375651 15:29127292-29127314 GCTCTGAGGGCACCTGGTGATGG - Intronic
1128615081 15:69102645-69102667 GCTTTAAGAGTCTCTGGTGAGGG + Intergenic
1129171417 15:73810436-73810458 GCTCCAATGGTCCCTGGTCAGGG + Intergenic
1131506470 15:93024477-93024499 GGTCTGAGGGTCCCTGGCCATGG - Exonic
1131899639 15:97073505-97073527 TTTGTAAGTGTCCCTTGTGAGGG + Intergenic
1134136851 16:11682446-11682468 GTTCTTAGGCTGCCTGGTGTGGG - Intronic
1138115938 16:54360628-54360650 GTCCTAAGGAGCCCTGGTAAAGG + Intergenic
1138352290 16:56352417-56352439 CTTCTAGGGGTCCCTGGGGTAGG + Intronic
1138509055 16:57497428-57497450 GGGCTGAGGGGCCCTGGTGAGGG - Intergenic
1139431554 16:66913550-66913572 CTTCAAAGGGTCCCGGGGGATGG + Exonic
1143765617 17:9135705-9135727 GTTCTAGGGCTCCCTGGAGTAGG + Intronic
1144258193 17:13490720-13490742 GTTCTTCAGGTCCGTGGTGAGGG + Intergenic
1145897342 17:28466936-28466958 GATTTAAGGGACCCTGGAGAAGG + Intronic
1146124259 17:30219429-30219451 GTTCCAAGGGTCCCAGGTACTGG - Intronic
1147138911 17:38450876-38450898 TTCCTGAGGGTCCCTGGGGAGGG - Intronic
1147882135 17:43660885-43660907 GTTCTAGGATTCTCTGGTGATGG - Intronic
1148151187 17:45397179-45397201 GTTCTCAGGCTCACTGGTGGAGG - Intronic
1148550895 17:48550423-48550445 GTTCGCAGGGTCCGTGGTGCTGG + Exonic
1149514592 17:57270791-57270813 GTTATAAGGTCCCCTGATGATGG - Intronic
1151854876 17:76713892-76713914 GTTCACAGGGCCGCTGGTGAGGG - Exonic
1152162261 17:78676142-78676164 GTAGAAAGGGTCCCTGCTGATGG + Exonic
1155166368 18:23235501-23235523 GCCCCAAGAGTCCCTGGTGAGGG - Intronic
1161352959 19:3803934-3803956 CTTCTCAGGGTCCCGGGTGGGGG - Intergenic
1166465645 19:43028100-43028122 GTCCGAAGTGACCCTGGTGAGGG + Intronic
1167126105 19:47549762-47549784 GTTCCAAGAGTACCAGGTGATGG - Intronic
928334177 2:30381810-30381832 GTTATAATGGTCCTTGATGATGG - Intergenic
930025972 2:47029357-47029379 GTTCTCAGGGTGCTCGGTGATGG - Exonic
932581250 2:72993990-72994012 GCTCTCAGGGTACCTGGGGAAGG + Intronic
932649176 2:73537114-73537136 GTGCTAAAGGCCTCTGGTGAAGG + Intronic
935918591 2:107986003-107986025 GTTCCTGGCGTCCCTGGTGATGG - Intergenic
935951083 2:108329442-108329464 GTTTTCAGGGTCCTTGGGGAAGG - Intergenic
935956517 2:108382408-108382430 GTTTTCAGGATCCGTGGTGAGGG - Exonic
936102188 2:109592035-109592057 CTTCTAAGGGTCTGTGGGGAGGG - Intronic
939064347 2:137464553-137464575 TTTCTGAGAGTCCCTGGTGGAGG + Intronic
939713778 2:145557436-145557458 GTCCTGAGGGTCCCTGCAGATGG + Intergenic
940325795 2:152423806-152423828 GGTCAAAAGGTCCTTGGTGAAGG + Intronic
946396625 2:219446596-219446618 GTTCTAGGGGTCCCGAGTTAAGG - Intronic
946812718 2:223543238-223543260 GTTCTAATGGTCCCTAATGCTGG + Intergenic
948424075 2:237876873-237876895 GTTCCACGGGTACCTGGGGATGG - Intronic
1169286135 20:4308732-4308754 TTTCCAAAGGTCCCTGGAGAAGG - Intergenic
1175077589 20:56389236-56389258 GTGATATGGATCCCTGGTGAAGG - Intronic
1175497661 20:59425938-59425960 GTTCTGAGGGCCCCAGGTGGTGG + Intergenic
1177300586 21:19239726-19239748 CTTCTAAGGGTAGTTGGTGAGGG - Intergenic
1178201204 21:30407833-30407855 GTTCTCAGGCTCGCTGGGGATGG + Intronic
1178604254 21:34021480-34021502 GTTCTCAGGGTCCCAGGAGAGGG - Intergenic
1180092471 21:45540119-45540141 GGCATCAGGGTCCCTGGTGATGG - Intronic
1180611421 22:17100591-17100613 GTTCTGTGGGTCCCAGGTGCTGG - Intronic
1180737869 22:18032110-18032132 GTTCTAAGTATCCCTGGGGTGGG - Intergenic
1181606898 22:23985811-23985833 GCCTTAAGGGTGCCTGGTGATGG + Intergenic
1182058618 22:27380725-27380747 GGTCTGAGGGCTCCTGGTGAGGG - Intergenic
1184453716 22:44597544-44597566 ACTCGAAGGGTCCCTGATGAGGG + Intergenic
1184877490 22:47284682-47284704 GTTCTGTGAGTCCCTGGTGCTGG + Intergenic
951168196 3:19507310-19507332 GCTCTGAGGTTCCCTGGTGGGGG - Intronic
954958314 3:54541550-54541572 GTTCTAAGCCACCCTGGTGGTGG + Intronic
955511301 3:59683147-59683169 CTTCTCTGGGTCCCTGGTCAAGG - Intergenic
955588919 3:60513718-60513740 GAGGGAAGGGTCCCTGGTGAGGG + Intronic
956067062 3:65408087-65408109 TTTCTGAGGGTCACTAGTGAAGG - Intronic
958428107 3:94003293-94003315 GTTTTAATAGTCCCTGGGGATGG + Intronic
960738891 3:120811079-120811101 GTTTTAAGACTCCCTGGAGAAGG + Intergenic
961216184 3:125162432-125162454 GATCTAAGGGACCCTGCTGATGG - Intronic
971680250 4:29690306-29690328 TTTTTAAGGGTCCATGGTTATGG - Intergenic
971873742 4:32276701-32276723 GAGATCAGGGTCCCTGGTGAGGG - Intergenic
978667609 4:111204579-111204601 GTTCTTATTGTCCCTGTTGAAGG + Intergenic
984846732 4:184114902-184114924 GTTCTCAGGCTCCATGGTCAGGG - Intronic
985975568 5:3416886-3416908 GTTCCAAGGGTTCCTGTTGAAGG + Intergenic
992640801 5:78767030-78767052 GTTCTGAGGATCTCTGGGGATGG - Intronic
1000623767 5:163515279-163515301 TTTATAATGGTCCCTGCTGATGG - Intronic
1009538880 6:64925732-64925754 GTTCTCAGGTTCCCAGGTGGTGG + Intronic
1010866313 6:80980264-80980286 GTCCTAACCATCCCTGGTGAGGG + Intergenic
1021154026 7:17186958-17186980 GGTGTAAAGGTCCCAGGTGATGG - Intergenic
1023038758 7:36154353-36154375 GTCCGAGGGGTCCCTGGGGATGG - Exonic
1029745439 7:102513465-102513487 GTTCCAAGGGTCTCAGGTGTTGG + Intronic
1029763378 7:102612444-102612466 GTTCCAAGGGTCTCAGGTGTTGG + Intronic
1034101249 7:148452375-148452397 CTTCAAAGGGTCCCTGTGGATGG + Intergenic
1035021113 7:155801036-155801058 GTTGTCAGGGTCCCAGGTGGAGG - Exonic
1035654385 8:1294480-1294502 GTTCTAAGTGTGATTGGTGATGG + Intergenic
1039816685 8:41100682-41100704 GTTCTGATGGTCCCTGAGGAAGG + Intergenic
1044239289 8:89869910-89869932 GTTCTAAGTGTCCATGTTGGGGG - Intergenic
1045284883 8:100781900-100781922 GTTCAAAGGGTGCATGGGGAAGG - Intergenic
1045710716 8:104980634-104980656 GTACTGAGTGTCCATGGTGATGG - Intronic
1046056479 8:109084511-109084533 TTTGTAGGGGTCCCTGGTGCAGG - Intergenic
1049936610 9:505556-505578 GTTCCACGGGACCCGGGTGAAGG - Intronic
1051343517 9:16132134-16132156 ATTTCCAGGGTCCCTGGTGAGGG + Intergenic
1056646363 9:88415380-88415402 GTTCTAGGGGCCTCTGGTGTAGG - Intronic
1061610152 9:131740381-131740403 GTTCTCTGTGTCTCTGGTGAGGG - Intergenic
1186113770 X:6283459-6283481 GTTGCAAGGGTCCGTGATGAAGG + Intergenic
1191900487 X:66035127-66035149 GTTCTAAGGGTCCCTGGTGAGGG - Intronic
1194114105 X:89874140-89874162 ATTGTAAAGGTCCATGGTGAAGG + Intergenic
1197039419 X:121917990-121918012 GTGCTAAGTGTCCCAGGGGAGGG + Intergenic