ID: 1191907577

View in Genome Browser
Species Human (GRCh38)
Location X:66110022-66110044
Sequence GCCCTCTAGAAAATGCCCCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191907577_1191907579 17 Left 1191907577 X:66110022-66110044 CCGTGGGGCATTTTCTAGAGGGC No data
Right 1191907579 X:66110062-66110084 AAGCATGTTATGCGTAGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191907577 Original CRISPR GCCCTCTAGAAAATGCCCCA CGG (reversed) Intergenic
No off target data available for this crispr