ID: 1191910539

View in Genome Browser
Species Human (GRCh38)
Location X:66144591-66144613
Sequence GTGAAAGGGCTCCCTGGCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191910532_1191910539 25 Left 1191910532 X:66144543-66144565 CCTTAGCTTTTGTGAAAGGATTT No data
Right 1191910539 X:66144591-66144613 GTGAAAGGGCTCCCTGGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191910539 Original CRISPR GTGAAAGGGCTCCCTGGCAG AGG Intergenic