ID: 1191911774

View in Genome Browser
Species Human (GRCh38)
Location X:66159337-66159359
Sequence CGGTGGAGATAGAGAGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191911767_1191911774 16 Left 1191911767 X:66159298-66159320 CCAATTAAAAGATTATGGTGACT No data
Right 1191911774 X:66159337-66159359 CGGTGGAGATAGAGAGAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191911774 Original CRISPR CGGTGGAGATAGAGAGAAGT GGG Intergenic
No off target data available for this crispr