ID: 1191917613

View in Genome Browser
Species Human (GRCh38)
Location X:66219831-66219853
Sequence CTGGATTATACTGGATTTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 39, 2: 32, 3: 42, 4: 151}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191917613_1191917627 12 Left 1191917613 X:66219831-66219853 CCCACAAATCCAGTATAATCCAG 0: 1
1: 39
2: 32
3: 42
4: 151
Right 1191917627 X:66219866-66219888 AGTCCCGGTGGGACTCTGGGTGG 0: 9
1: 25
2: 41
3: 50
4: 166
1191917613_1191917624 8 Left 1191917613 X:66219831-66219853 CCCACAAATCCAGTATAATCCAG 0: 1
1: 39
2: 32
3: 42
4: 151
Right 1191917624 X:66219862-66219884 GTCCAGTCCCGGTGGGACTCTGG 0: 17
1: 31
2: 16
3: 33
4: 120
1191917613_1191917622 0 Left 1191917613 X:66219831-66219853 CCCACAAATCCAGTATAATCCAG 0: 1
1: 39
2: 32
3: 42
4: 151
Right 1191917622 X:66219854-66219876 TGGGGGCTGTCCAGTCCCGGTGG 0: 30
1: 44
2: 29
3: 36
4: 161
1191917613_1191917628 13 Left 1191917613 X:66219831-66219853 CCCACAAATCCAGTATAATCCAG 0: 1
1: 39
2: 32
3: 42
4: 151
Right 1191917628 X:66219867-66219889 GTCCCGGTGGGACTCTGGGTGGG 0: 8
1: 24
2: 40
3: 57
4: 205
1191917613_1191917625 9 Left 1191917613 X:66219831-66219853 CCCACAAATCCAGTATAATCCAG 0: 1
1: 39
2: 32
3: 42
4: 151
Right 1191917625 X:66219863-66219885 TCCAGTCCCGGTGGGACTCTGGG 0: 8
1: 31
2: 39
3: 41
4: 97
1191917613_1191917623 1 Left 1191917613 X:66219831-66219853 CCCACAAATCCAGTATAATCCAG 0: 1
1: 39
2: 32
3: 42
4: 151
Right 1191917623 X:66219855-66219877 GGGGGCTGTCCAGTCCCGGTGGG 0: 29
1: 35
2: 18
3: 25
4: 100
1191917613_1191917621 -3 Left 1191917613 X:66219831-66219853 CCCACAAATCCAGTATAATCCAG 0: 1
1: 39
2: 32
3: 42
4: 151
Right 1191917621 X:66219851-66219873 CAGTGGGGGCTGTCCAGTCCCGG 0: 36
1: 24
2: 15
3: 39
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191917613 Original CRISPR CTGGATTATACTGGATTTGT GGG (reversed) Intronic
900903202 1:5531095-5531117 CTGGCATATACTTGATTTCTAGG - Intergenic
902041194 1:13493574-13493596 GGGGATTATCCTGGATTTGCAGG + Intronic
904513159 1:31031303-31031325 CTGGTTGAAACTGTATTTGTAGG - Intronic
907172785 1:52485851-52485873 TTGGTCTATACTGGATTGGTTGG + Intronic
908533448 1:65055527-65055549 CTGGATTATACGGTATTCCTAGG + Intergenic
908624995 1:66030346-66030368 CAGGAAGATGCTGGATTTGTAGG + Intronic
909562515 1:77022404-77022426 CTGCATTATATTGGCTTTCTTGG - Intronic
910852618 1:91663732-91663754 CTGGATTATACTGGATATGTGGG - Intergenic
912816300 1:112831418-112831440 CTGGATTATACCGGATATGTGGG + Intergenic
912980165 1:114364247-114364269 CTGGACTATACTGGATATGCAGG - Intergenic
913231877 1:116746722-116746744 CTGGATTACATTGGTTTTGCTGG - Intergenic
914839767 1:151238764-151238786 CTGGACGGTACTTGATTTGTTGG + Intronic
916029779 1:160865624-160865646 CTGGTTTATATTGATTTTGTAGG - Intergenic
917054122 1:170959780-170959802 ATGGATTCTATAGGATTTGTAGG + Intronic
917250597 1:173055768-173055790 TTGGTTAATACTAGATTTGTTGG + Intergenic
918015125 1:180625740-180625762 GTAGATTGAACTGGATTTGTTGG - Intergenic
918645550 1:186900064-186900086 CTGGGTTAAACTGTATTTGTTGG + Intronic
918646829 1:186915657-186915679 CGGCATTATACTGGATATGTGGG - Intronic
921074976 1:211693285-211693307 CTGGATTATACTGGATATGTGGG + Intergenic
921986301 1:221316661-221316683 ATGAATGATACTGGGTTTGTTGG - Intergenic
922676618 1:227556886-227556908 CTGGTCTCTATTGGATTTGTGGG + Intergenic
922690443 1:227684941-227684963 CTGGATTATACTGGATATGTAGG + Intergenic
924632319 1:245752628-245752650 CAGGAATATACTGGATCAGTGGG - Intronic
924858715 1:247899601-247899623 CTGGATTATACTGGATATGTAGG - Intergenic
1063620741 10:7646215-7646237 CTAGAATATACTGAGTTTGTGGG - Intronic
1064552156 10:16513945-16513967 CTGGAATTTTCTGGATTTGAGGG - Exonic
1064621554 10:17222547-17222569 CTGGATTATGGAGTATTTGTAGG - Intergenic
1065112672 10:22455282-22455304 CTGGGTTCTACTGGATGTGCCGG + Intergenic
1068132643 10:52913529-52913551 CTGGATTGGACTGGGTTTATAGG + Intergenic
1068671457 10:59727742-59727764 CTGGATTATATTGGATATGTGGG - Intronic
1069694506 10:70376803-70376825 CTGGGTTCTACTGGTTTTCTGGG + Intronic
1069939516 10:71944898-71944920 CTGGACTATACTGGATATGCGGG + Intergenic
1070239357 10:74662672-74662694 CTGGAGTATACTGAATGTGGGGG - Intronic
1071282576 10:84115885-84115907 CTGGATTATACTGGATATGTGGG + Intergenic
1071397112 10:85235074-85235096 CTGGATTTTCCTGGAAATGTTGG + Intergenic
1071561780 10:86651153-86651175 CTGGATTAGGCTGGATTAGCTGG - Intergenic
1071800215 10:89051546-89051568 CTTGATTATACTGGGTTTATGGG - Intergenic
1073774937 10:106774598-106774620 CTGGACTTTAATGGATATGTCGG - Intronic
1073986047 10:109210292-109210314 CTGGACTTTAATGGAATTGTGGG - Intergenic
1077588699 11:3474848-3474870 CTGGACTATACTAGATATGTAGG - Intergenic
1081185549 11:40038091-40038113 ATGGATCATACAGGACTTGTGGG + Intergenic
1083081890 11:60102660-60102682 CTGGATTATACTGGATATGTGGG - Intergenic
1083090235 11:60191893-60191915 CTGGATTATACTGGATATGTGGG + Intergenic
1083109860 11:60395222-60395244 CTGCATTAAACTCGATTTCTTGG + Intronic
1083197524 11:61097546-61097568 CTGGATTATACTGGATATGTGGG + Intergenic
1084244394 11:67846475-67846497 CTGGACTATACTAGATATGTAGG - Intergenic
1084828293 11:71748086-71748108 CTGGACTATACTAGATATGTAGG + Intergenic
1086973112 11:93104808-93104830 CTGGATTATACTGGATATGTGGG - Intergenic
1087783295 11:102324933-102324955 CTGGAGTTTACAGGATTTGATGG - Exonic
1087895087 11:103577813-103577835 CTGGATTATACAGGATAAGTGGG + Intergenic
1089463627 11:118668243-118668265 CAGGGTAATACTGGCTTTGTAGG - Intronic
1090197819 11:124831990-124832012 CTGCAATATCCTGGATTTGGTGG + Intergenic
1091352512 11:134908470-134908492 CTGGGTTATGCTGCATCTGTAGG + Intergenic
1091814157 12:3423657-3423679 CTGGATTATACTGGATATGTGGG - Intronic
1092414962 12:8283619-8283641 CTGGACTATACTAGATATGTAGG - Intergenic
1092699776 12:11215290-11215312 CTTGATTAGACTGGAGTTATGGG - Intergenic
1093593757 12:20938320-20938342 CTGGATTATACTGGATATGAGGG - Intergenic
1095594835 12:43947676-43947698 TTGCATTACACTGAATTTGTGGG + Intronic
1097330315 12:58325858-58325880 CTGATTTGCACTGGATTTGTGGG + Intergenic
1098248743 12:68546669-68546691 CTTGATTATACTGAATATGTGGG + Intergenic
1098748991 12:74271749-74271771 CTGGATCATACTGGATATGTAGG + Intergenic
1099392132 12:82094619-82094641 TAGGATGATACTGGCTTTGTAGG + Intergenic
1100183144 12:92107198-92107220 TGGGATTATAGTGGAGTTGTGGG + Intronic
1101028168 12:100634328-100634350 CTGGATTGTACTGGGCATGTGGG - Intergenic
1101782062 12:107845536-107845558 TTGGAGTAGACAGGATTTGTGGG + Intergenic
1107894241 13:44943745-44943767 GAGGATTATTATGGATTTGTTGG - Intronic
1108564361 13:51680447-51680469 CAGGATCATACTGGATTAGGGGG - Intronic
1109084727 13:57955267-57955289 CTGGATTATACTGAAGCTATAGG - Intergenic
1109869292 13:68311769-68311791 TTGGAATATATTGGATATGTTGG - Intergenic
1117466557 14:56000198-56000220 CTGAATTATATTGGATGAGTAGG + Intergenic
1117954952 14:61115656-61115678 CTGGACTATACTGGATATGCGGG - Intergenic
1118513647 14:66504301-66504323 CTTGCTTATACTGAAATTGTGGG + Intergenic
1119564159 14:75614593-75614615 CTGGAATATAGGGGATTTATAGG + Intronic
1121402034 14:93688461-93688483 CTGGATCTTTCTGGCTTTGTAGG + Intronic
1123892910 15:24799157-24799179 CATGATTTTACTGGATTTCTGGG + Intergenic
1124398786 15:29330493-29330515 CATGATTAGACTGGATTTGGAGG - Intronic
1124580161 15:30946235-30946257 ATGAATTATTCTGGATTTGTTGG - Intronic
1126009999 15:44293607-44293629 CAGGATTAGACTGGAGTTGTGGG + Intronic
1127095925 15:55512306-55512328 CTGGATTATACTGGCTATGTGGG - Intergenic
1129574612 15:76728976-76728998 CTGTGTTATACTTGTTTTGTGGG + Intronic
1131748208 15:95473453-95473475 CTGGGTAAAACTGGATTTTTTGG + Intergenic
1137041369 16:35615904-35615926 CTGGATTATACTGGATGTGCGGG - Intergenic
1139759213 16:69170852-69170874 CTGGATTAGACTGGACTATTAGG + Intronic
1141839129 16:86563252-86563274 CCGGATTACAATGGATTTTTAGG + Intergenic
1145864474 17:28231823-28231845 CTGGACTATACTGGATATGTGGG - Intergenic
1147610181 17:41797415-41797437 CTGGAATTTACTGAATTTGCGGG + Intergenic
1148828618 17:50413970-50413992 CTGGACTATACTGGATATGTGGG - Intergenic
1152455299 17:80412221-80412243 CTGGATTATACTGGATATGTAGG + Intergenic
1153830723 18:8920060-8920082 CTGGATTATACTGGATATGTGGG + Intergenic
1158292442 18:55956679-55956701 CTGGATTATACTGGATATGTGGG + Intergenic
1163878422 19:19896514-19896536 CTGGATTATACTGGATATGTAGG + Intergenic
1163942862 19:20511152-20511174 CTGGATTATACTGGATATGTGGG - Intergenic
1163966008 19:20748141-20748163 CTGGACTATACTGGATATGTGGG - Intronic
1164130395 19:22356475-22356497 CTGAATTATACCGAATATGTGGG - Intergenic
1164216561 19:23155808-23155830 CTGGATTATACTGGATATGTGGG - Intergenic
1164808468 19:31137527-31137549 CTGAATTACACTGGCTTTCTGGG + Intergenic
1165605255 19:37097359-37097381 GTGGATTATAGTGGATTTCTAGG + Intronic
1166642051 19:44501425-44501447 CTGGAGTCTGCTGGATCTGTTGG - Intergenic
1167758973 19:51431732-51431754 CTGGATTACACTGTATTTCTAGG + Intergenic
927758454 2:25727900-25727922 CTGGATTATAAAGTATTTGATGG - Intergenic
928853315 2:35774897-35774919 CTGGATTGTAATGGCTTTGTGGG - Intergenic
929986480 2:46738446-46738468 CAGGATTGTACTTGATTTCTTGG - Intronic
930738796 2:54808052-54808074 ATGGATTATACGGGTTCTGTGGG + Intronic
933730240 2:85450740-85450762 CTGGATTACACTGGATGGATTGG + Intergenic
935343782 2:102084180-102084202 CTTCATTTTACTGGATTTTTTGG - Intronic
935721139 2:105980378-105980400 CTGGATTATACTGGATATGTGGG - Intergenic
935970924 2:108530158-108530180 CTAGATTGTACTGGATATGTAGG + Intergenic
936419212 2:112347413-112347435 CTAGATTGTACTGGATATGTAGG - Intergenic
938024427 2:127933809-127933831 CAGGGTAATACTGGACTTGTAGG - Intergenic
938445300 2:131372273-131372295 TTTGATTAAACTGTATTTGTAGG + Intergenic
939628706 2:144509965-144509987 CTGGATGCTTCAGGATTTGTAGG - Intronic
939938132 2:148317056-148317078 CTGCTTTATACTGGAGTTTTGGG - Intronic
941552267 2:166932108-166932130 TTGTATTTTTCTGGATTTGTTGG + Intronic
944145229 2:196500749-196500771 CTAGACTATACTGGATTTCAAGG + Intronic
946099544 2:217307697-217307719 TTGGATCATACTGAATTTGTGGG + Intronic
947144101 2:227048485-227048507 CTGGATATTTCTGGATATGTTGG - Intronic
947595287 2:231407501-231407523 CCGGACTATACCGGATATGTGGG + Intergenic
948338015 2:237226306-237226328 CTGAATTAGACTGGGTTTGTGGG + Intergenic
1170061950 20:12268542-12268564 CTGGCACATACTGAATTTGTAGG - Intergenic
1170956922 20:20989601-20989623 CTGTATGATATTGTATTTGTGGG + Intergenic
1171408859 20:24932621-24932643 CTGGACTATACTGGATATGTGGG + Intergenic
1175513578 20:59552848-59552870 CTGGATTATACTGAATATGTAGG - Intergenic
1177131170 21:17257542-17257564 CTGGATAATGCTGGATCTGAAGG + Intergenic
1177354969 21:19996467-19996489 CTGGATTATACTGGAGGTGTGGG - Intergenic
1178448066 21:32663461-32663483 CTGGATTATACTGTATATGTGGG + Intronic
1178761508 21:35406838-35406860 GTGGTTTATACTGCAGTTGTAGG - Intronic
1179670552 21:42944035-42944057 CTGGATTATACTGGATATGTAGG - Intergenic
1185152766 22:49175351-49175373 TTGGATTATGCTCTATTTGTTGG + Intergenic
951165705 3:19483204-19483226 CTGGATTATACTGGATATGTGGG - Intronic
951248203 3:20365251-20365273 CTGGATTATACTGGATATGTGGG - Intergenic
951965200 3:28374531-28374553 AGGGATTATATTGAATTTGTAGG + Intronic
952008479 3:28871304-28871326 CAGTATGATACTAGATTTGTGGG + Intergenic
952025134 3:29071280-29071302 CAGGATTATGCTGGACTCGTAGG + Intergenic
953337874 3:42109304-42109326 CTGGATTTTATTGGGTTTGATGG - Intronic
956775154 3:72558964-72558986 CTAGATCTTACTGGATTTGGGGG - Intergenic
957022859 3:75143651-75143673 CTGGACTATACTGGATATGTAGG + Intergenic
957406565 3:79779692-79779714 CTGGATTATACTGGATATGTGGG + Intergenic
961892511 3:130142230-130142252 CTGGACTATACTAGATATGTAGG - Intergenic
962097720 3:132309117-132309139 CTGGATTATACTGGATATGTGGG + Intergenic
962277394 3:134026342-134026364 CTGGATTATACTAGATACGTAGG + Intronic
962500502 3:135986391-135986413 CTGGATTTAACTGGCTCTGTGGG - Intronic
964392516 3:156212526-156212548 CTGGATGTTACTGGCTATGTGGG + Intronic
964522047 3:157580502-157580524 CTGGATTATACTGGGTAAGTGGG - Intronic
964924367 3:161937808-161937830 TTGGATTATACTGGATATGTAGG + Intergenic
964932658 3:162045804-162045826 CTGGATTATACTGTGTATGTGGG - Intergenic
966261627 3:177985265-177985287 CAGGATTACTTTGGATTTGTTGG + Intergenic
966873355 3:184306856-184306878 TTGGAATATACTGGTTTTGATGG + Intronic
968948770 4:3679477-3679499 CTGGACTGGACTGGATTTCTTGG + Intergenic
969750254 4:9104912-9104934 CTGGACTATACTAGATATGTAGG + Intergenic
969943043 4:10753995-10754017 CTGGATTCCACTGGAATTATGGG + Intergenic
971211445 4:24621693-24621715 CTGGATTATACCAGATATGTGGG - Intergenic
972217382 4:36912051-36912073 CTGGATTATACTGGATATGTAGG + Intergenic
972990880 4:44821584-44821606 CTGGATTATACTGGATATGTGGG - Intergenic
974376880 4:61089508-61089530 CTAGATTATACCACATTTGTAGG + Intergenic
974593653 4:63988484-63988506 TAGGATGATACTGGGTTTGTGGG - Intergenic
974790110 4:66677300-66677322 CAGGATGATACTGGCTTTGTAGG - Intergenic
975206007 4:71644688-71644710 CTGGATTATACTGGATATGTGGG + Intergenic
976542693 4:86296255-86296277 CTGGTTAAGACTGGATTTGTGGG + Intronic
977043211 4:92039718-92039740 CTGGATTATACTGGATATGTGGG - Intergenic
979716137 4:123841023-123841045 TAGTATTATACTGGTTTTGTAGG + Intergenic
980554698 4:134387935-134387957 CTTGATTATCCTGGCTTTTTTGG - Intergenic
980780501 4:137485742-137485764 CTGGATTATAGTGGATATGTGGG + Intergenic
981573032 4:146173922-146173944 CTGTATGATACTGTAATTGTGGG + Intergenic
983522301 4:168722370-168722392 ATGGATTATACTGTAAATGTTGG - Intronic
983655287 4:170077000-170077022 CTGAAATCAACTGGATTTGTGGG + Intronic
983898312 4:173104951-173104973 CTGGATTATACTGGATATGTAGG + Intergenic
984693715 4:182757550-182757572 CTTGATTAAAATGCATTTGTAGG - Intronic
986543576 5:8871997-8872019 CTGGATTATTGGGGATGTGTGGG + Intergenic
989095693 5:37779340-37779362 CTGGACTATACTGTATATGTGGG - Intergenic
989690716 5:44140494-44140516 CAGGATAATAATGGCTTTGTAGG + Intergenic
991675825 5:69089121-69089143 CTGGATTATACTGGTTATGTAGG - Intergenic
992645333 5:78806527-78806549 CTGGATTTTAAAGCATTTGTAGG + Intronic
994441222 5:99806591-99806613 CTGGATCTTAATGGATGTGTAGG - Intergenic
995081880 5:108060905-108060927 CTGCATTACACTGCATCTGTGGG - Intronic
995474178 5:112531347-112531369 CTGGATTATACTGGATATGTGGG + Intergenic
996066689 5:119086966-119086988 CTGGATTTTATTGAATTTGCTGG + Intronic
999274699 5:150321819-150321841 ATGAGTTGTACTGGATTTGTGGG - Intronic
999888352 5:155948925-155948947 CTGGTTTGAACTGCATTTGTCGG - Intronic
1000237154 5:159372571-159372593 CTGGATTACAGTGGATATGGGGG + Intergenic
1002406375 5:179036416-179036438 CTGGATTATAGTAGTTTTGTTGG - Intergenic
1002998767 6:2311687-2311709 CTGGATTATACTGGATATGCGGG - Intergenic
1003123919 6:3340106-3340128 CTGGATAATACCGCTTTTGTGGG - Intronic
1005462280 6:26080441-26080463 CTGGATTATACTGGATATGTGGG + Intergenic
1007188009 6:39988926-39988948 TTGGATGATACTGATTTTGTTGG + Intergenic
1007335232 6:41150765-41150787 CTGGTTGATACTGGAATGGTAGG + Intronic
1008040864 6:46796805-46796827 CTGGATTATAATGGGATTGAGGG - Intronic
1008123822 6:47646843-47646865 CTGGATTATACCGGATATGTGGG + Intergenic
1012769460 6:103411491-103411513 CTGGCATAAACTAGATTTGTTGG - Intergenic
1014546544 6:122742793-122742815 CTGGATTATACTGGATATGTGGG - Intergenic
1015172265 6:130266658-130266680 CTGGATTATACGGGATATGTAGG + Intronic
1018776435 6:167021242-167021264 CTAAATTATAATGAATTTGTGGG - Intronic
1020043488 7:5022158-5022180 CTGGATTATACTGGATATGTAGG - Intronic
1020322721 7:6951733-6951755 CTGGACTATACTAGATATGTAGG - Intergenic
1021411216 7:20331329-20331351 CTGGGTGATGCTGGATCTGTGGG - Exonic
1021849096 7:24790550-24790572 CCAGATTATACTGGATATGTGGG - Intergenic
1022254095 7:28638506-28638528 CTGGCTTATTTTGGATTTTTTGG + Intronic
1023542756 7:41283610-41283632 CTGGATTTTGCTGCATTTTTAGG + Intergenic
1025823331 7:64991761-64991783 CTGGCCTCTACTGGATCTGTGGG - Exonic
1028007894 7:85600719-85600741 CTGGCTGCTACTGGTTTTGTGGG - Intergenic
1028185291 7:87777776-87777798 CTTGATGATACTGGATTTCCAGG + Exonic
1029822172 7:103157011-103157033 CTGGATTATACTGCATATATAGG + Intergenic
1030022162 7:105286260-105286282 CTGAATACGACTGGATTTGTAGG - Intronic
1030363371 7:108619051-108619073 ATGGAATATACTGATTTTGTTGG + Intergenic
1031509660 7:122634168-122634190 CAGGATAATGCTGGCTTTGTAGG + Intronic
1032171130 7:129585443-129585465 CTGGACTGTATTGGATATGTGGG + Intergenic
1032324918 7:130918508-130918530 TTGTGTTAAACTGGATTTGTTGG - Intergenic
1033108941 7:138558125-138558147 CTGGCCTCTACTGGATCTGTGGG - Intronic
1033813862 7:145049311-145049333 GTGGATTATACTGAATCTGTAGG + Intergenic
1036373334 8:8179246-8179268 CTGGACTATACTAGATACGTAGG + Intergenic
1036877574 8:12486395-12486417 CTGGACTATACTAGATACGTAGG - Intergenic
1037003907 8:13752842-13752864 CTGGTTCACAGTGGATTTGTGGG + Intergenic
1037156091 8:15700895-15700917 CTGGATGATACTGGAGAAGTGGG - Intronic
1038090014 8:24242028-24242050 CTGGATTACACTGGATATGTGGG + Intergenic
1039235585 8:35498963-35498985 CTGCTTTATACTGAATTGGTTGG - Intronic
1039278750 8:35958975-35958997 CTGGACTATACTGGATATGTGGG + Intergenic
1039876654 8:41592256-41592278 CTGGATTATACTGGATATGTGGG - Intronic
1039975174 8:42357677-42357699 CTGGATGATAGTGAAGTTGTGGG + Intronic
1040743551 8:50611479-50611501 CTGGATTATAATCGATTTGCTGG + Intronic
1041227467 8:55714749-55714771 CTGGATTATACTGGATATGTGGG + Intronic
1041515809 8:58697567-58697589 CTGGATTGTACTGGATATATAGG + Intergenic
1043578383 8:81683830-81683852 TTGGATCATACTGATTTTGTGGG - Intronic
1044893622 8:96864184-96864206 CTGGCTTATTCTGGAGTTGGAGG + Intronic
1049634341 8:143678768-143678790 CTGGATTATACTGAATGTGTGGG + Intergenic
1049881902 8:145070660-145070682 CTGGCCTATACTGGAAATGTGGG - Intergenic
1050092439 9:2028588-2028610 CTGTATTTTAATGGCTTTGTGGG + Intronic
1052508427 9:29383378-29383400 CTGGATTATACTGGATATGTGGG + Intergenic
1058511428 9:105722873-105722895 CTAGATTATAGTAGAATTGTGGG + Intronic
1058533998 9:105936095-105936117 CATGATTATACTGGGTTTATGGG - Intergenic
1059140707 9:111850557-111850579 CTGCATCATACAGCATTTGTAGG - Intergenic
1185910318 X:3974884-3974906 CTGGATTATACTGGATATATGGG + Intergenic
1186240985 X:7566113-7566135 CAGGATTAGACTGGGTTTATAGG + Intergenic
1188309867 X:28603119-28603141 TTGGATCATACTGGAGTTGTAGG + Intronic
1188310023 X:28604952-28604974 TTGGATCATACTTGACTTGTGGG + Intronic
1188893705 X:35641416-35641438 ATGGAAAATACTGGAGTTGTAGG + Intergenic
1189671748 X:43417972-43417994 CAGGATTATACTGGGGCTGTTGG + Intergenic
1190270629 X:48860495-48860517 CTAGATTATACCGGATATGTGGG + Intergenic
1190314400 X:49140787-49140809 CTGGACTATACTGGATATGTAGG - Intergenic
1190367367 X:49709064-49709086 CTCTAGAATACTGGATTTGTAGG + Intergenic
1190425483 X:50331265-50331287 CTGGATTTTACTGGATATGTGGG - Intronic
1190651095 X:52569587-52569609 CAGGACTATACTGGATCTCTGGG - Intergenic
1190771586 X:53519157-53519179 CTAGATTATACTGGATATGTGGG + Intergenic
1190898473 X:54644823-54644845 CGGGATTATATTGAATTTATAGG + Intergenic
1190926106 X:54906427-54906449 CTTGATTAAACTGGGTTTATGGG + Intergenic
1191639568 X:63415430-63415452 CTGGATTATACTGGATATGTAGG + Intergenic
1191738478 X:64412315-64412337 CTGGACTATTGTGGATGTGTAGG + Intergenic
1191917613 X:66219831-66219853 CTGGATTATACTGGATTTGTGGG - Intronic
1192915135 X:75643948-75643970 CTGGATTATACTGGATATGTGGG - Intergenic
1193070545 X:77301297-77301319 CTAGAGTATACTGGATATGTGGG + Intergenic
1193717684 X:84951181-84951203 CTGGATTGTACTGGATATGTGGG + Intergenic
1193731443 X:85108180-85108202 CTGGATTATACCTGTTTGGTTGG + Exonic
1194384733 X:93238352-93238374 CTGGATTATACTGGATATGTGGG + Intergenic
1194400927 X:93437149-93437171 CTGGACTATACTGGATATGTGGG + Intergenic
1196422665 X:115539017-115539039 CTAGATTATACTGGATATGTAGG - Intergenic
1196459716 X:115917716-115917738 CTGGATTATACTGGATATGTGGG - Intergenic
1197637368 X:128930311-128930333 ATGCTTTATACTGGGTTTGTGGG - Intergenic
1198148092 X:133879076-133879098 CTGGATTACTGTGGCTTTGTTGG + Intronic
1199420668 X:147640672-147640694 ATGCATTATACTGTATTAGTAGG - Intergenic
1199549764 X:149046189-149046211 CTGTATTATATTGTAGTTGTGGG - Intergenic
1200912557 Y:8543946-8543968 CCGGACTATACTGGATATGTGGG + Intergenic
1200943699 Y:8810414-8810436 CTGGATTATACTGGATATGTGGG + Intergenic
1200948628 Y:8870098-8870120 CTGGACTATACTGGATATGTGGG + Intergenic
1200983300 Y:9281707-9281729 CTGGACTATGCTGGATATCTGGG - Intergenic
1201297126 Y:12473502-12473524 ATGGATTATACTGGATATGTGGG - Intergenic
1202127081 Y:21577990-21578012 CTGGACTATGCTGGATATCTGGG + Intergenic
1202152172 Y:21853529-21853551 CTGGACTATACTGGATATCTGGG - Intergenic