ID: 1191923246

View in Genome Browser
Species Human (GRCh38)
Location X:66279495-66279517
Sequence CTAAGGCTGCACTCAGGAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191923240_1191923246 20 Left 1191923240 X:66279452-66279474 CCACAGCTGGAACTAGAGTGGCT No data
Right 1191923246 X:66279495-66279517 CTAAGGCTGCACTCAGGAGTAGG No data
1191923237_1191923246 30 Left 1191923237 X:66279442-66279464 CCTCTTTTACCCACAGCTGGAAC No data
Right 1191923246 X:66279495-66279517 CTAAGGCTGCACTCAGGAGTAGG No data
1191923239_1191923246 21 Left 1191923239 X:66279451-66279473 CCCACAGCTGGAACTAGAGTGGC No data
Right 1191923246 X:66279495-66279517 CTAAGGCTGCACTCAGGAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191923246 Original CRISPR CTAAGGCTGCACTCAGGAGT AGG Intergenic