ID: 1191932923

View in Genome Browser
Species Human (GRCh38)
Location X:66394129-66394151
Sequence GTTATCTGCAGAAGACAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191932923_1191932926 18 Left 1191932923 X:66394129-66394151 CCCTGCTGTCTTCTGCAGATAAC No data
Right 1191932926 X:66394170-66394192 GACAGCTTTTGGCCTGTTACTGG No data
1191932923_1191932925 7 Left 1191932923 X:66394129-66394151 CCCTGCTGTCTTCTGCAGATAAC No data
Right 1191932925 X:66394159-66394181 TTTTTTTGAGAGACAGCTTTTGG No data
1191932923_1191932928 25 Left 1191932923 X:66394129-66394151 CCCTGCTGTCTTCTGCAGATAAC No data
Right 1191932928 X:66394177-66394199 TTTGGCCTGTTACTGGGCTTTGG No data
1191932923_1191932927 19 Left 1191932923 X:66394129-66394151 CCCTGCTGTCTTCTGCAGATAAC No data
Right 1191932927 X:66394171-66394193 ACAGCTTTTGGCCTGTTACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191932923 Original CRISPR GTTATCTGCAGAAGACAGCA GGG (reversed) Intergenic
No off target data available for this crispr