ID: 1191932926

View in Genome Browser
Species Human (GRCh38)
Location X:66394170-66394192
Sequence GACAGCTTTTGGCCTGTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191932924_1191932926 17 Left 1191932924 X:66394130-66394152 CCTGCTGTCTTCTGCAGATAACT No data
Right 1191932926 X:66394170-66394192 GACAGCTTTTGGCCTGTTACTGG No data
1191932923_1191932926 18 Left 1191932923 X:66394129-66394151 CCCTGCTGTCTTCTGCAGATAAC No data
Right 1191932926 X:66394170-66394192 GACAGCTTTTGGCCTGTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191932926 Original CRISPR GACAGCTTTTGGCCTGTTAC TGG Intergenic
No off target data available for this crispr