ID: 1191934617

View in Genome Browser
Species Human (GRCh38)
Location X:66413034-66413056
Sequence CTCTGTAAAAAGAAGTATGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191934617_1191934624 12 Left 1191934617 X:66413034-66413056 CCAACATACTTCTTTTTACAGAG No data
Right 1191934624 X:66413069-66413091 AAGGAGGTGATTCATTGTCTAGG No data
1191934617_1191934619 -7 Left 1191934617 X:66413034-66413056 CCAACATACTTCTTTTTACAGAG No data
Right 1191934619 X:66413050-66413072 TACAGAGCCTGGCATGCCCAAGG No data
1191934617_1191934620 -4 Left 1191934617 X:66413034-66413056 CCAACATACTTCTTTTTACAGAG No data
Right 1191934620 X:66413053-66413075 AGAGCCTGGCATGCCCAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191934617 Original CRISPR CTCTGTAAAAAGAAGTATGT TGG (reversed) Intergenic
No off target data available for this crispr