ID: 1191935850

View in Genome Browser
Species Human (GRCh38)
Location X:66426554-66426576
Sequence GCGCCGTTTTTTAAGCTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191935850_1191935854 3 Left 1191935850 X:66426554-66426576 CCCACCAGCTTAAAAAACGGCGC No data
Right 1191935854 X:66426580-66426602 ACGAGATTATATCCCGCACCTGG 0: 307
1: 1004
2: 2073
3: 1436
4: 947
1191935850_1191935857 12 Left 1191935850 X:66426554-66426576 CCCACCAGCTTAAAAAACGGCGC No data
Right 1191935857 X:66426589-66426611 TATCCCGCACCTGGCTCGGAGGG 0: 496
1: 1490
2: 1803
3: 1148
4: 796
1191935850_1191935856 11 Left 1191935850 X:66426554-66426576 CCCACCAGCTTAAAAAACGGCGC No data
Right 1191935856 X:66426588-66426610 ATATCCCGCACCTGGCTCGGAGG 0: 494
1: 1487
2: 1828
3: 1188
4: 779
1191935850_1191935855 8 Left 1191935850 X:66426554-66426576 CCCACCAGCTTAAAAAACGGCGC No data
Right 1191935855 X:66426585-66426607 ATTATATCCCGCACCTGGCTCGG 0: 636
1: 1265
2: 1149
3: 581
4: 360

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191935850 Original CRISPR GCGCCGTTTTTTAAGCTGGT GGG (reversed) Intergenic
No off target data available for this crispr