ID: 1191940338

View in Genome Browser
Species Human (GRCh38)
Location X:66473095-66473117
Sequence TAGCTAAGGGAGTCACAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191940338_1191940340 -10 Left 1191940338 X:66473095-66473117 CCTTTCTGTGACTCCCTTAGCTA No data
Right 1191940340 X:66473108-66473130 CCCTTAGCTAGCAGAGAGCTTGG No data
1191940338_1191940342 -3 Left 1191940338 X:66473095-66473117 CCTTTCTGTGACTCCCTTAGCTA No data
Right 1191940342 X:66473115-66473137 CTAGCAGAGAGCTTGGACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191940338 Original CRISPR TAGCTAAGGGAGTCACAGAA AGG (reversed) Intergenic
No off target data available for this crispr