ID: 1191941261

View in Genome Browser
Species Human (GRCh38)
Location X:66483858-66483880
Sequence GACAGTCCTTGGCCTGTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191941261_1191941263 15 Left 1191941261 X:66483858-66483880 CCAGTAACAGGCCAAGGACTGTC No data
Right 1191941263 X:66483896-66483918 AGTTATCTGCAGAAGATGACAGG 0: 21
1: 199
2: 184
3: 120
4: 249

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191941261 Original CRISPR GACAGTCCTTGGCCTGTTAC TGG (reversed) Intergenic
No off target data available for this crispr