ID: 1191942480

View in Genome Browser
Species Human (GRCh38)
Location X:66496361-66496383
Sequence ACATGGGTATAGAGAGTAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191942480_1191942485 28 Left 1191942480 X:66496361-66496383 CCTTCTACTCTCTATACCCATGT No data
Right 1191942485 X:66496412-66496434 CCAATAAATGATAACAAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191942480 Original CRISPR ACATGGGTATAGAGAGTAGA AGG (reversed) Intergenic
No off target data available for this crispr