ID: 1191946354

View in Genome Browser
Species Human (GRCh38)
Location X:66539018-66539040
Sequence GACTGCTCTTGGTCTGTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191946351_1191946354 16 Left 1191946351 X:66538979-66539001 CCTAGTCATCTTTTGCAGATAAT No data
Right 1191946354 X:66539018-66539040 GACTGCTCTTGGTCTGTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191946354 Original CRISPR GACTGCTCTTGGTCTGTTAC TGG Intergenic
No off target data available for this crispr