ID: 1191946891

View in Genome Browser
Species Human (GRCh38)
Location X:66544334-66544356
Sequence CTGTGGTGATGGTGGCAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191946891_1191946903 22 Left 1191946891 X:66544334-66544356 CCCTTTTGCCACCATCACCACAG No data
Right 1191946903 X:66544379-66544401 CTACTGCCAATGTTTACTTAAGG No data
1191946891_1191946899 -1 Left 1191946891 X:66544334-66544356 CCCTTTTGCCACCATCACCACAG No data
Right 1191946899 X:66544356-66544378 GGCCCATAGGGAGTACTGCCAGG No data
1191946891_1191946904 23 Left 1191946891 X:66544334-66544356 CCCTTTTGCCACCATCACCACAG No data
Right 1191946904 X:66544380-66544402 TACTGCCAATGTTTACTTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191946891 Original CRISPR CTGTGGTGATGGTGGCAAAA GGG (reversed) Intergenic
No off target data available for this crispr