ID: 1191949528

View in Genome Browser
Species Human (GRCh38)
Location X:66573131-66573153
Sequence CAGTATTAGATCATTGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191949528_1191949533 14 Left 1191949528 X:66573131-66573153 CCTGCCTCAATGATCTAATACTG No data
Right 1191949533 X:66573168-66573190 AAGTCTCCCTCTATTATTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191949528 Original CRISPR CAGTATTAGATCATTGAGGC AGG (reversed) Intergenic
No off target data available for this crispr