ID: 1191953487

View in Genome Browser
Species Human (GRCh38)
Location X:66619494-66619516
Sequence CTTAGGTTGTGGAGGTGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 316
Summary {0: 1, 1: 0, 2: 7, 3: 28, 4: 280}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191953487_1191953496 25 Left 1191953487 X:66619494-66619516 CCCTCTCACCTCCACAACCTAAG 0: 1
1: 0
2: 7
3: 28
4: 280
Right 1191953496 X:66619542-66619564 TTCACCCCAACTCTGACATGGGG 0: 1
1: 1
2: 3
3: 13
4: 126
1191953487_1191953494 23 Left 1191953487 X:66619494-66619516 CCCTCTCACCTCCACAACCTAAG 0: 1
1: 0
2: 7
3: 28
4: 280
Right 1191953494 X:66619540-66619562 TTTTCACCCCAACTCTGACATGG 0: 1
1: 0
2: 0
3: 14
4: 160
1191953487_1191953495 24 Left 1191953487 X:66619494-66619516 CCCTCTCACCTCCACAACCTAAG 0: 1
1: 0
2: 7
3: 28
4: 280
Right 1191953495 X:66619541-66619563 TTTCACCCCAACTCTGACATGGG 0: 1
1: 0
2: 1
3: 11
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191953487 Original CRISPR CTTAGGTTGTGGAGGTGAGA GGG (reversed) Intronic
900823167 1:4905653-4905675 CTTGTGTTGTGGGTGTGAGAGGG - Intergenic
903640832 1:24859148-24859170 CTGAGGTTGAGGAGATGAGGGGG + Intergenic
903663262 1:24991516-24991538 CTTAGTTTGGGCAGGTGAGCAGG + Intergenic
903852834 1:26318477-26318499 CTGTGGTTATGGAGGTGACAGGG + Intronic
904563925 1:31415918-31415940 CTTTGGATGGGGAGGTAAGATGG + Intronic
907327800 1:53652266-53652288 CTGAGGATGTGGAGATGAGTTGG + Intronic
907735046 1:57104062-57104084 GGTAGGTTATGGGGGTGAGAAGG + Intronic
908451648 1:64262017-64262039 TTTAGGTTGTGAAGGGGAGAGGG - Intronic
908686001 1:66720616-66720638 CTTAGGAAGTTGAGGTGGGAGGG + Intronic
910213436 1:84817379-84817401 CCTAGGGTGTGGAGGTGCGTGGG + Intronic
911041115 1:93591850-93591872 CTTAGCTTCGGGAGGAGAGAGGG - Intronic
912203082 1:107480465-107480487 CTTCGTTTGTGGAGGGGAGGGGG + Intronic
912239859 1:107894985-107895007 CTTTGGCAGTGGAGGTGAGAGGG - Intronic
912734011 1:112134017-112134039 TTTGGGGTGTGGAGATGAGAGGG + Intergenic
912817443 1:112840677-112840699 CTTAGGAAGTTGAGGTGGGAGGG + Intergenic
912997827 1:114549332-114549354 CTGAGGCTGTGGAATTGAGAGGG - Intergenic
915205773 1:154269461-154269483 CTGAGGCTGTGAAGGTGAAATGG - Intronic
915646451 1:157276209-157276231 TTTAGTTTGTGGAGGTGGGAGGG + Intergenic
916501713 1:165393137-165393159 CTTGGGTTGTGCAGCTGCGAGGG - Intergenic
918355689 1:183705223-183705245 CTTAGTTTGTGGAGGTGGGAGGG + Intronic
918556820 1:185811488-185811510 CTTAGGAGGCGGAGGTGGGAAGG + Intronic
919893794 1:201995572-201995594 CTGGGGTTGGGGAGCTGAGATGG + Intronic
920227191 1:204447342-204447364 CTTTGGGAGTGGAGGTGGGAAGG - Intronic
921541755 1:216424610-216424632 CTTAGGATGCTGAGGTGGGAGGG + Intergenic
921798800 1:219378551-219378573 CAAAGGTAGTGGAGGTGAGTAGG + Intergenic
1065274154 10:24068273-24068295 CTGAGGGTGTGGAGCTAAGATGG - Intronic
1065697673 10:28394763-28394785 TTTGGGTGGTCGAGGTGAGAGGG + Intergenic
1066214127 10:33269399-33269421 CTTAGGAGGTTGAGGTGGGAGGG - Intronic
1070050700 10:72886846-72886868 CTGAAGTTGTGGAGGTGGGAGGG - Exonic
1070892923 10:79955543-79955565 GTGAGGTTGTGGTGGAGAGAGGG - Intronic
1071146915 10:82585684-82585706 CTTAGAGAGTGTAGGTGAGATGG - Intronic
1071179829 10:82970405-82970427 CTTGGGAAGTGGAGGTGGGAGGG - Intronic
1071705303 10:87991893-87991915 CTTAGGTTGTGAATTTGAAAAGG + Intergenic
1072474047 10:95741716-95741738 CTTAGAATTTGGAGGAGAGAGGG + Intronic
1073302509 10:102479672-102479694 ACTAGGTTGTAGAGGTGGGAAGG - Exonic
1074850181 10:117433126-117433148 CTTTGGTTTAGGGGGTGAGAAGG + Intergenic
1077730108 11:4721440-4721462 CTGAAGTGGTGGAGGAGAGAGGG - Intronic
1078139281 11:8680336-8680358 CTAACGTGGTGGAGGTGTGAAGG + Intergenic
1078425272 11:11244652-11244674 GTTAAATTCTGGAGGTGAGATGG - Intergenic
1078602115 11:12742422-12742444 CAGAGGTTTTGGGGGTGAGAGGG + Intronic
1082581623 11:54876835-54876857 CTATGGTTGTGGAGGGGGGAGGG + Intergenic
1083211511 11:61190242-61190264 CTCAGGTGGCTGAGGTGAGAGGG + Intergenic
1083243836 11:61410203-61410225 CTTAGGAGGTGGAGGTGGGAGGG - Intronic
1085933426 11:81114165-81114187 CTTAGGTGGTGGTAGTGGGAAGG - Intergenic
1087048782 11:93866346-93866368 CTTAGTTTGTGGAGGTGGGAGGG + Intergenic
1087251495 11:95905155-95905177 ATGAGGTTAAGGAGGTGAGATGG - Intronic
1088463782 11:110111783-110111805 CTTGGGATGCTGAGGTGAGAGGG - Intronic
1088824064 11:113478824-113478846 CCAAGGTTGTGGAGTTTAGATGG - Intergenic
1090672455 11:128958337-128958359 CTTAGGGTGTGGAACTGAGAAGG - Intergenic
1091669265 12:2440767-2440789 CTTGGGATATGGAGGTGAGGGGG - Intronic
1091747836 12:3003907-3003929 CTGAGGTGGTGGCGGTGGGAGGG - Intronic
1092937320 12:13376215-13376237 CAGAGGCTGTGGAGGTGAGTGGG - Exonic
1094091734 12:26657387-26657409 CCTAGGTGATGGAGTTGAGAGGG - Intronic
1095909810 12:47414711-47414733 CTTCTGTGGTGGGGGTGAGAAGG + Intergenic
1096358884 12:50966503-50966525 CTGAGGGTGTGGAGGTGGGAAGG - Intronic
1096750572 12:53756302-53756324 CTTACTTTGGGGAGGTAAGAGGG - Intergenic
1096773476 12:53950678-53950700 CTCAGGTTGGGGTGGAGAGATGG + Intergenic
1097049772 12:56215398-56215420 CTTAGGTGGTGGTGGTGATGGGG + Intronic
1097614594 12:61868744-61868766 CTTAGCTTGAGGAGGTTATAGGG + Intronic
1099751462 12:86779492-86779514 CTGGGGAAGTGGAGGTGAGAGGG + Intronic
1099861735 12:88231142-88231164 CTTAGTTTGCAGAGGTGGGAGGG - Intergenic
1100210888 12:92397545-92397567 CTTAGGTTGTGAAGGTGTTTGGG - Intergenic
1100568920 12:95827519-95827541 CATATGTTGAGGATGTGAGATGG - Intergenic
1100854633 12:98748287-98748309 CTAAGGGTGAGGAGGTGAGCAGG + Intronic
1101172271 12:102110391-102110413 CTTGGGAGGCGGAGGTGAGAGGG + Intronic
1103324988 12:120114623-120114645 CGTAGGTTGTGCAGAGGAGATGG - Intronic
1105021105 12:132817349-132817371 CTTAGAGTGTGGAGGTGTGGAGG - Intronic
1105021173 12:132817646-132817668 CTTAGAGTGTGGAGGTGTGGGGG - Intronic
1105021234 12:132817910-132817932 CTTAGAGTGTGGAGGTGTGGGGG - Intronic
1105021251 12:132817975-132817997 CTTAGAGTGTGGAGGTGTGGGGG - Intronic
1106297492 13:28429886-28429908 CTTGGGTGGTGGAGGTGAGAAGG - Intronic
1106557655 13:30824063-30824085 CTTATGCTGTAGGGGTGAGATGG + Intergenic
1106820527 13:33459256-33459278 CTTGGGTGCTGGAGGTGGGAGGG - Intergenic
1110425034 13:75357473-75357495 CTGGAGTTGGGGAGGTGAGAAGG - Intronic
1111433869 13:88180830-88180852 CTGAGGGTGTGGGGGTGTGATGG - Intergenic
1111453178 13:88446025-88446047 ATTTGGCTGTGAAGGTGAGAGGG - Intergenic
1112373540 13:98816887-98816909 ATGAGGCTGTGGAGGTGGGAAGG + Intronic
1112632667 13:101179682-101179704 CTTAGCTTTGGGAGCTGAGATGG - Intronic
1114181502 14:20371926-20371948 CCTGGGCTGTGGAGATGAGAAGG - Intronic
1114237045 14:20832876-20832898 CTTAGTTTGTGGAGGTGGGAGGG + Intergenic
1114317683 14:21523345-21523367 CTCAGAGAGTGGAGGTGAGAAGG - Exonic
1115444370 14:33472291-33472313 ATTAGGTTGGAGAGGTAAGAGGG + Intronic
1117636505 14:57750037-57750059 CTCAGGGTGAGGAGATGAGAGGG - Intronic
1119381376 14:74231250-74231272 CTTAGATTGTGGTGGAGAGTAGG + Intergenic
1119741695 14:77017913-77017935 CTTTAGCTGTGGAGGAGAGATGG + Intergenic
1120901410 14:89578953-89578975 CTCAGGTGGCTGAGGTGAGAGGG - Intronic
1121679484 14:95780862-95780884 GTTAGATTTTGGAGGTGATAGGG - Intergenic
1121943225 14:98093050-98093072 ATTAGGTTGTGGGAGTGAAAGGG + Intergenic
1122057588 14:99115123-99115145 CTTAGGATGAGGAAATGAGATGG - Intergenic
1122226039 14:100280441-100280463 TTTTGGTAGTGGAGTTGAGAGGG + Exonic
1125363386 15:38888432-38888454 AGTAGGTTGTGGAAGGGAGATGG - Intergenic
1126445366 15:48737189-48737211 CTTAGGTGGTGATGGGGAGACGG - Intronic
1126890004 15:53194654-53194676 CTTAGGTTGTGTAGGTGAGGTGG + Intergenic
1127346411 15:58105176-58105198 CTCAGGAAGTTGAGGTGAGAGGG - Intronic
1127987239 15:64083329-64083351 CTTAGGGTTTGGAGGTCAGAAGG - Intronic
1128712898 15:69885332-69885354 CCTGGGTGGAGGAGGTGAGAAGG - Intergenic
1129248986 15:74297874-74297896 CTTAGCTTGGGGAGGGCAGAGGG - Intronic
1129591665 15:76920579-76920601 CTGAGGATGTGGTGGAGAGAAGG - Intergenic
1129671784 15:77611724-77611746 CTTAGGTGGTGGTTGGGAGATGG + Intergenic
1130570569 15:85039459-85039481 GTGAGGATGTGGAGGAGAGAAGG + Intronic
1133066381 16:3210345-3210367 CTTTGGTTATGGAGGTGATGTGG + Intergenic
1133708942 16:8382467-8382489 ATTACATTGTGGAGGAGAGATGG + Intergenic
1133984346 16:10656846-10656868 CTCAGGAGGTGGAGGTGGGAGGG - Intronic
1135243856 16:20837111-20837133 CTTAGGTGTTTGAGGAGAGAGGG + Intronic
1135957834 16:26971031-26971053 CTTAGGAGGTTGAGGTGGGAGGG + Intergenic
1138037085 16:53619059-53619081 CTTGGGTTTTGGAAGTGACACGG + Exonic
1138610498 16:58119842-58119864 CTTAGGTTGGGAACATGAGATGG - Intronic
1138610512 16:58119918-58119940 CTTAGGTTGGGAACATGAGATGG - Intronic
1138610526 16:58119994-58120016 CTTAGGTTGGGAACATGAGATGG - Intronic
1138610533 16:58120032-58120054 CTTAGGTTGGGAACATGAGATGG - Intronic
1140514244 16:75530703-75530725 TTTAGGTTGTGGAGCTAAAAGGG + Exonic
1141277774 16:82603777-82603799 CTTAGGTTGGGGAGATGATCTGG + Intergenic
1141692786 16:85606059-85606081 CTTCTGTGGTGGAGGTGAGAAGG - Intergenic
1143502805 17:7348787-7348809 CCTAGGGTGTGGGGGAGAGACGG - Intronic
1144385109 17:14742040-14742062 CTTTGGTGGTGGTGGTGGGAGGG + Intergenic
1144688810 17:17245435-17245457 CTTAGGCTTTGGAGGTCATATGG - Intergenic
1145940483 17:28740996-28741018 CTTGGGCTCTGGAGGTCAGAGGG + Intronic
1148235181 17:45964002-45964024 CTCTGGGTGAGGAGGTGAGAGGG + Intronic
1149141242 17:53435747-53435769 CTGTGGTTGTTGAGATGAGATGG + Intergenic
1149900035 17:60467562-60467584 CTTATGTTCTAGTGGTGAGAAGG + Intronic
1150294771 17:64001870-64001892 CTGAGGTTGAGGGAGTGAGAAGG - Exonic
1151774895 17:76193896-76193918 CTGTGGATGTGGAGGTGGGAGGG - Intronic
1153825556 18:8871033-8871055 CTGAGTTTCTGGAGGTGGGAAGG - Intergenic
1153861338 18:9211456-9211478 TTTAGGTTGTTAGGGTGAGAAGG + Intronic
1155108785 18:22693412-22693434 ATTAGGTTATGGTGTTGAGAAGG - Intergenic
1156332895 18:36141426-36141448 ATTAGGTGGGGGAGGAGAGATGG + Intronic
1156657208 18:39302939-39302961 CTTAAGTAGTGAAAGTGAGAAGG - Intergenic
1157681230 18:49608671-49608693 CTTAGGATTTGGAGCTCAGAAGG + Intergenic
1157919483 18:51699849-51699871 CTTAGTTTGTGGAGGTGGGAGGG - Intergenic
1158170040 18:54587307-54587329 CTTGGGATGCGGAGGTGGGAGGG + Intergenic
1158614581 18:58974806-58974828 GTGAGCTTGTGGAGGTCAGAGGG - Intronic
1159985407 18:74835419-74835441 CTGAGGGTGTGCAGTTGAGATGG + Intronic
1161989900 19:7678716-7678738 CTCAAGTTGTGGAGGGGCGATGG + Intronic
1162229207 19:9251638-9251660 CTAAGGTGGAGGAGTTGAGAAGG - Exonic
1163344144 19:16729268-16729290 ATAAGGTTGGGGAGGTGAGCAGG - Intronic
1164264307 19:23598507-23598529 CTAAGGGTGTGCACGTGAGAGGG + Intronic
1164550849 19:29211397-29211419 CTTGGGACCTGGAGGTGAGAAGG - Intronic
1165427300 19:35753240-35753262 CTGAGGATGAGGAGGTGGGATGG + Exonic
1165601483 19:37058533-37058555 CCTAGGCTGTGGAGGGGTGAGGG + Intronic
1167116018 19:47489481-47489503 CTGAGGTTGGGGAGGTCAGGAGG - Intronic
1167991566 19:53365505-53365527 TTTGGGTTTTGGAGGCGAGATGG - Intergenic
1168635897 19:57996625-57996647 CACAGGCTGTGGAGATGAGAGGG + Intronic
927374388 2:22396791-22396813 CTTTGGTCGCGGAGGAGAGAGGG - Intergenic
928021175 2:27706270-27706292 CTGAGGGTGGGGAGGTGGGAGGG + Exonic
928138433 2:28706549-28706571 CTCAGGAGGTTGAGGTGAGATGG + Intergenic
929301759 2:40311874-40311896 CTGAGTTTGTGGAGATGATAAGG - Intronic
931198484 2:60075039-60075061 CTGGGGATGGGGAGGTGAGATGG - Intergenic
932134024 2:69212912-69212934 CTTAGGAGGCTGAGGTGAGAGGG - Intronic
933167897 2:79095481-79095503 CTTAGTTTGCAGAGGTGGGAAGG + Intergenic
933427398 2:82130140-82130162 CTTTGGTTTTGGAGGTGGGGGGG - Intergenic
934161098 2:89250434-89250456 CTCACGTTGTGGAGGTGGAAGGG - Intergenic
934206179 2:89931999-89932021 CTCACGTTGTGGAGGTGGAAGGG + Intergenic
935832171 2:107011598-107011620 CTCTGGTTGTGGTGGTGATATGG + Intergenic
936290631 2:111221073-111221095 ATTTGGGTGTGGGGGTGAGAGGG - Intergenic
938528693 2:132162137-132162159 CTCAGGTTGAGGAGGGGACAGGG - Intronic
938717846 2:134037108-134037130 CTTTGTTTGTGGTGGTGAGTTGG - Intergenic
941662930 2:168214095-168214117 CTTAGGATGTGGAGGTGGGCAGG - Intronic
942034997 2:172001986-172002008 CTTGGGAGGTGGAGGTGGGAGGG + Intronic
942438105 2:176002629-176002651 CAAAGGTTGGGGAGTTGAGAAGG + Intronic
942700819 2:178707806-178707828 CTTAGGTTCTGGAATTGAAAAGG + Exonic
943875156 2:193058091-193058113 TTTAGATTGTGGTGGGGAGAGGG + Intergenic
945973751 2:216254617-216254639 CTTGTATTGTGGAGGTGAGAGGG - Intergenic
946152227 2:217784369-217784391 ATTAGGCTGTGGAGGTGGGCAGG - Intergenic
1168872130 20:1138715-1138737 CTTAGGGTGCTGAGGTGAAAGGG + Intronic
1169066907 20:2698849-2698871 GTTAGGTTTTGGTGGGGAGAAGG + Intronic
1170309684 20:14978677-14978699 CTTGGGTTTTGGAGATGAAATGG - Intronic
1170506947 20:17036474-17036496 ACTTGGTTGTGAAGGTGAGAAGG + Intergenic
1174087493 20:48019531-48019553 CTGAGGTTGAGGAGGGAAGAGGG + Intergenic
1174391365 20:50220213-50220235 CTTGGGTGGTGGAGGTGAGAAGG + Intergenic
1175614596 20:60385329-60385351 CTTAGGGTTTGGGAGTGAGAAGG + Intergenic
1175618668 20:60424688-60424710 CCTGGGTGGTGGGGGTGAGAGGG - Intergenic
1175681774 20:60994643-60994665 CTGAGGTAGAGGAGGTGGGAGGG - Intergenic
1175844639 20:62051996-62052018 TTGTGGTTGTGGAGGTGACATGG - Intronic
1178094227 21:29197113-29197135 TTTCTGTTGTGGAGGAGAGAAGG + Intronic
1178344052 21:31810023-31810045 GTTAGCTTGAGGAGGTGGGAGGG + Intergenic
1179123941 21:38575064-38575086 CTGAGGCTCTGGAGGTGAGAGGG - Intronic
1179667251 21:42921408-42921430 CTTAGTTTGCGGAGGCGGGAGGG + Intergenic
1179885016 21:44310148-44310170 CTAAGGGTGTGGAGAGGAGAAGG - Intronic
1181719018 22:24759659-24759681 CTTAACTTGTGGAAGGGAGATGG - Intronic
1182580273 22:31304420-31304442 GTTGGGTATTGGAGGTGAGATGG + Intergenic
949982258 3:9509092-9509114 CTCAGGTTGCGGAGGGGAGGAGG - Intronic
951710998 3:25584830-25584852 CTTACCTCGTGGATGTGAGATGG + Intronic
952307396 3:32158364-32158386 CTTTGGTGGTGGAGGTGGGCTGG + Intronic
954454131 3:50587922-50587944 CTGAGGGTTTGGATGTGAGATGG + Intergenic
959127468 3:102307664-102307686 CTTAGCTTGAGGAGAGGAGAGGG + Intronic
959902450 3:111675363-111675385 GGGAGGTTGTGGAGGTGAGGGGG - Exonic
960430133 3:117559233-117559255 TTTAGGTAGTGGGGGTGAGGGGG - Intergenic
961757044 3:129134421-129134443 CTCAGGTTGTGGAAGTGGGGAGG - Intronic
963185999 3:142417548-142417570 CTTAAATAGTGGGGGTGAGACGG + Intronic
964550041 3:157875530-157875552 TATAGGTTGAGGAGATGAGAAGG - Intergenic
966757478 3:183384967-183384989 ATTCGGTAGTGCAGGTGAGAGGG - Intronic
966856295 3:184196175-184196197 CCTAGCTTTTGGAGGTGAGAGGG + Intronic
967207557 3:187137998-187138020 CTTAGGTTCTGAAATTGAGAAGG + Intronic
967653347 3:192014495-192014517 CTCAGGAGGTGGAGGTGGGAGGG - Intergenic
970863965 4:20737887-20737909 TTTGGGTGGTGGAGGTGGGAAGG + Intronic
971417072 4:26441710-26441732 CAGAGGTTGGGAAGGTGAGAAGG - Intergenic
974950604 4:68580044-68580066 CTTAGTTTGTGGAGGCGGGAGGG - Intronic
974958997 4:68675563-68675585 CTTAGTTTGTGGAGGCGGGAGGG - Intergenic
975956383 4:79845015-79845037 TTGAGGTTGTGGGGGTGGGAAGG + Intergenic
976299808 4:83507012-83507034 CTTAGTTTGTGGAGGCGGGAGGG + Intronic
977049093 4:92104181-92104203 CTTAGGAGGCTGAGGTGAGAGGG - Intergenic
978041782 4:104073497-104073519 CTTAGGTAGTGGATGTGATTAGG + Intergenic
979229972 4:118337608-118337630 CTTAGGTTTTGGTGCTGAGGAGG - Intronic
979675929 4:123410392-123410414 CTCAGGAGGTTGAGGTGAGAGGG - Intergenic
979881351 4:125963670-125963692 CTAAGGTTGTGCAGGTCAGTGGG - Intergenic
980048774 4:128017952-128017974 GTTAGGGTGTGGAGGAGAAATGG - Intronic
980744892 4:137000763-137000785 CTCAGCCTGTGGGGGTGAGATGG - Intergenic
985818775 5:2145996-2146018 CTTAGGTCGTGATGGTGAGGAGG - Intergenic
986747095 5:10754436-10754458 CATAGACTGTGAAGGTGAGAAGG + Intronic
987154128 5:15070854-15070876 CTTAGATTGTGGCGGGGAGCAGG + Intergenic
988442810 5:31251041-31251063 CCTAGATGGTGGAGGTGAGAAGG - Intronic
990250924 5:53914311-53914333 CTTAAGTTGTTGAAGTGAGAGGG - Intronic
992357834 5:76003816-76003838 CATAGGGTGTGGAGCTCAGAGGG + Intergenic
995248839 5:109966157-109966179 CTTAGCTCTGGGAGGTGAGAGGG - Intergenic
998405553 5:141872616-141872638 CTCAGGTTGTGACTGTGAGATGG - Intronic
998523931 5:142825427-142825449 CTGAGGTTATGGAGATGAGAAGG + Intronic
998682075 5:144479662-144479684 CTTAGGAAGTAGAGGAGAGAGGG - Exonic
999275554 5:150327634-150327656 CCTTGGCTGTGGAGGTGAGGTGG - Intronic
999361257 5:150988541-150988563 CTTAGGTTGGAGAGGGGAGAAGG + Intergenic
999780404 5:154844967-154844989 CTTACTTTCTGGTGGTGAGAAGG + Intronic
1001899845 5:175417640-175417662 CTTAGGTCGGGGAGCTAAGATGG - Intergenic
1002436445 5:179234673-179234695 CCTTGGATGTGGAGATGAGATGG - Intronic
1002829229 6:804241-804263 CTTAGGGTCTGCTGGTGAGATGG + Intergenic
1003232208 6:4264589-4264611 CTTTGGTTCTGCTGGTGAGATGG + Intergenic
1003291807 6:4786143-4786165 CTAAGGAGGTGGAGGTGGGAGGG + Intronic
1003566458 6:7226827-7226849 CTTGGGTTGTTGGGTTGAGAAGG + Intronic
1004348141 6:14867117-14867139 TTAACGTTGTGGAGGTGAGCTGG - Intergenic
1005401202 6:25436434-25436456 CTTGCGTGGTGGAGGTGGGAGGG + Intronic
1005882207 6:30070418-30070440 CCCAGGTTGAGGAGGAGAGAGGG + Exonic
1007322960 6:41040480-41040502 CTTCCCTGGTGGAGGTGAGAGGG + Intronic
1008042758 6:46819202-46819224 GTGGGTTTGTGGAGGTGAGAAGG + Intronic
1008669238 6:53749745-53749767 CTTAGGTGGGGCGGGTGAGAAGG + Intergenic
1010008091 6:71017694-71017716 CTCAGGTGGCTGAGGTGAGAGGG + Intergenic
1012768633 6:103400559-103400581 CTTATGTGGTGGAGGGGACAAGG + Intergenic
1014911043 6:127093303-127093325 GTTAGGTGGTGGAGGTGGGAAGG - Intergenic
1015196126 6:130526495-130526517 CTTAGGTCCTGGAGTTGGGAGGG + Intergenic
1016022373 6:139249611-139249633 CTTGGGGTGTGGGTGTGAGAGGG + Intronic
1017420710 6:154269361-154269383 CATGGGTGGTGGAGGTGGGATGG + Intronic
1019747974 7:2711149-2711171 CTGAGGCTGTGGAGGGAAGAGGG + Intronic
1020786045 7:12573709-12573731 CTTAGGTTAGGGATGTGACAGGG - Intronic
1021640695 7:22733709-22733731 TTTAGGTCGGGGAGGGGAGAGGG - Intergenic
1022003481 7:26246760-26246782 CTTAGTGTGTGGAGGCGGGAGGG - Intergenic
1022190487 7:28012927-28012949 CTTAGGTTGTGGTGGGAAAAAGG - Intronic
1022498258 7:30866581-30866603 CTTAGGAAGCGGAGGAGAGATGG + Intronic
1022611785 7:31882732-31882754 CTTAGGTTCTAGAATTGAGATGG - Intronic
1022617299 7:31944427-31944449 CTGAGGGTGGGCAGGTGAGAGGG + Intronic
1024983262 7:55174909-55174931 TTTAGGATGTGGAGATGAGCAGG - Intronic
1025261448 7:57421734-57421756 CTGGGGAGGTGGAGGTGAGAGGG + Intergenic
1025738774 7:64178929-64178951 CTGGGGAGGTGGAGGTGAGAGGG + Intronic
1026414423 7:70163329-70163351 GTTAGGTTGTGGTGGTGGGGGGG + Intronic
1026533039 7:71216463-71216485 CTTTGCTTTTGGAGGGGAGAGGG + Intronic
1026541027 7:71280159-71280181 CTGAGGTTGTGGAAGAGACAGGG + Intronic
1027201359 7:76065741-76065763 CTCAGTTTCTGCAGGTGAGACGG + Intronic
1027246816 7:76373254-76373276 GTTAGGGGGTGGAGGTGGGAGGG + Intergenic
1028795506 7:94897302-94897324 CTGGGGTTGGGGAGGTGAGAAGG - Intergenic
1029510661 7:100992825-100992847 CTGAGGTTGTGGAGCTGTCAGGG - Exonic
1029510850 7:100994082-100994104 CTGAGGTTGTGGTGCTGTGAGGG - Exonic
1029511150 7:100996074-100996096 CTGAGGTTGTGGAGCTGTCAGGG - Exonic
1029511344 7:100997331-100997353 CTGAGGTTGTGGGGGTGCGAGGG - Exonic
1029511570 7:100998753-100998775 CTGAGGTTGTGGTGCTGCGAGGG - Exonic
1029511878 7:101000745-101000767 CTGAGGTTGTGGAGCTGTCAGGG - Exonic
1029512068 7:101002002-101002024 CTGAGGTTGTGGTGCTGCGAGGG - Exonic
1029512370 7:101003994-101004016 CTGAGGTTGTGGAGCTGTCAGGG - Exonic
1030278633 7:107745834-107745856 CTTTTTTTGTAGAGGTGAGACGG + Intronic
1035414380 7:158670551-158670573 CTTAGGGTGATGAGGTGAGGGGG - Intronic
1036387721 8:8296375-8296397 CTTAGAAAGTGGATGTGAGAAGG - Intergenic
1038705144 8:29886439-29886461 CTGGGGCTGGGGAGGTGAGATGG + Intergenic
1038921887 8:32093788-32093810 CTTAGGATGTGGAGTTGGGAAGG + Intronic
1039189566 8:34957499-34957521 TGTAGATAGTGGAGGTGAGATGG - Intergenic
1042590913 8:70397968-70397990 TTTTGGTTGGGGAGGTGGGAGGG - Intronic
1046827652 8:118709324-118709346 GTTAGGTTGTGTAGGTTATATGG + Intergenic
1047209880 8:122832714-122832736 CTTAGTTTGCGGAGGCGGGAGGG + Intronic
1047482724 8:125300285-125300307 CTCAGGAGGTGGAGGTGAGGTGG - Intronic
1048226525 8:132592495-132592517 CTGAGGTTGTGGATGTAAGCAGG + Intronic
1048407319 8:134136902-134136924 CTTGGGGTGTGGAGGTCATATGG + Intergenic
1048717504 8:137285130-137285152 CTTAGTTTGTGGAGGCGGGAGGG - Intergenic
1052243082 9:26298407-26298429 GTTAGGTTGTGGAGTTCAGAAGG - Intergenic
1052384426 9:27807281-27807303 CTTAGGTTGGAGAGGGGAGGAGG + Intergenic
1053311384 9:37022952-37022974 CTTAGAGGGTGGTGGTGAGAAGG + Intronic
1054352828 9:64033014-64033036 CTTAGGAGGCTGAGGTGAGAGGG - Intergenic
1056662160 9:88551981-88552003 CTCAGCATGTGGAGGTGGGAGGG + Intronic
1056722089 9:89081453-89081475 CTCAGGGTGTGGGGGTGGGAGGG - Intronic
1056939083 9:90939767-90939789 TTTAGCTTGTGTGGGTGAGATGG - Intergenic
1058835532 9:108855947-108855969 TCTAGGCTGTGGATGTGAGAAGG - Exonic
1059285264 9:113166763-113166785 CTAAGGTAGTGGGGGTGAAAGGG + Intronic
1059707024 9:116834939-116834961 CTTGGGATGTTGAGGTGGGAAGG + Intronic
1060036675 9:120261756-120261778 CTTAGGACTTAGAGGTGAGAAGG - Intergenic
1060217406 9:121746607-121746629 CTTGGGTGGAGGAGATGAGATGG + Intronic
1060282636 9:122224642-122224664 ACTAGGATCTGGAGGTGAGAGGG - Intronic
1061492626 9:130954486-130954508 CTAAGGGTGTGGTGGTGGGAAGG - Intergenic
1061753463 9:132796886-132796908 CCAGGGTGGTGGAGGTGAGAGGG + Intronic
1062266682 9:135689732-135689754 CTTTGGTGAGGGAGGTGAGAGGG - Intergenic
1186384785 X:9099072-9099094 CTTAGGAGGTTGAGGTGGGAGGG - Intronic
1187593541 X:20745422-20745444 GTTGGGTTGTGGAGTGGAGATGG + Intergenic
1188105708 X:26144801-26144823 TTCAGGTTGAGGAGGTGAGGAGG - Intergenic
1189575998 X:42354199-42354221 CTTATGTGGTGGAGGGGGGATGG + Intergenic
1190245085 X:48685663-48685685 CTTGGGGTGTGGAGAGGAGATGG + Intronic
1191953487 X:66619494-66619516 CTTAGGTTGTGGAGGTGAGAGGG - Intronic
1192670400 X:73134399-73134421 CTTAGGTTGGTGTTGTGAGATGG - Intergenic
1192946002 X:75966190-75966212 CTTAGTTTGCAGAGGTGGGAGGG + Intergenic
1194141807 X:90218066-90218088 CTTAGGTTGGAGAGGGGAGGAGG + Intergenic
1195939966 X:110159874-110159896 CTTAGGGTGAGGAGGTGAAAGGG + Intronic
1196001728 X:110794475-110794497 CACAGGTAGTGGAGGTGGGATGG + Intronic
1196194141 X:112822512-112822534 ATTGGGTTGTGGTGGGGAGAGGG + Exonic
1196230837 X:113219117-113219139 CTGAGGTGGAGGAGGAGAGAAGG - Intergenic
1197133696 X:123035820-123035842 CTTAGGAAGTGGAGTTGGGAAGG - Intergenic
1198238575 X:134761102-134761124 CTTAGGTTTTTGAGGGGAAAAGG + Intronic
1198472492 X:136960561-136960583 GTTTGGTTGGGGAGGTGGGATGG + Intergenic
1198670457 X:139074737-139074759 CTGAGGCTGAGGAGTTGAGAAGG - Intronic
1199033613 X:143028237-143028259 CTTAGGTTGGAGAGGGGAGGAGG + Intronic
1199391197 X:147281278-147281300 CTTTGGTTTTAGAGGTGAAAAGG - Intergenic
1199391416 X:147283976-147283998 CTTTGGTTTTAGAGGTGAAAAGG - Intergenic
1199391634 X:147286675-147286697 CTTTGGTTTTAGAGGTGAAAAGG - Intergenic
1199764613 X:150931995-150932017 CCTAGGTTCTGGAGGGGAGGTGG - Intergenic
1199779364 X:151044272-151044294 CTTAGGTTCTGGATGGGAGATGG - Intergenic
1200487568 Y:3787178-3787200 CTTAGGTTGGAGAGGGGAGGAGG + Intergenic