ID: 1191954159

View in Genome Browser
Species Human (GRCh38)
Location X:66625620-66625642
Sequence TCTAGGGCCCCGTGTACTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 56}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191954153_1191954159 17 Left 1191954153 X:66625580-66625602 CCATGGTAGCTGAAGACAAAGGG 0: 67
1: 205
2: 256
3: 326
4: 486
Right 1191954159 X:66625620-66625642 TCTAGGGCCCCGTGTACTACTGG 0: 1
1: 0
2: 0
3: 4
4: 56
1191954150_1191954159 21 Left 1191954150 X:66625576-66625598 CCCACCATGGTAGCTGAAGACAA 0: 4
1: 99
2: 205
3: 295
4: 478
Right 1191954159 X:66625620-66625642 TCTAGGGCCCCGTGTACTACTGG 0: 1
1: 0
2: 0
3: 4
4: 56
1191954148_1191954159 26 Left 1191954148 X:66625571-66625593 CCCTACCCACCATGGTAGCTGAA 0: 3
1: 57
2: 134
3: 206
4: 306
Right 1191954159 X:66625620-66625642 TCTAGGGCCCCGTGTACTACTGG 0: 1
1: 0
2: 0
3: 4
4: 56
1191954149_1191954159 25 Left 1191954149 X:66625572-66625594 CCTACCCACCATGGTAGCTGAAG 0: 3
1: 56
2: 133
3: 198
4: 279
Right 1191954159 X:66625620-66625642 TCTAGGGCCCCGTGTACTACTGG 0: 1
1: 0
2: 0
3: 4
4: 56
1191954151_1191954159 20 Left 1191954151 X:66625577-66625599 CCACCATGGTAGCTGAAGACAAA 0: 5
1: 129
2: 203
3: 310
4: 573
Right 1191954159 X:66625620-66625642 TCTAGGGCCCCGTGTACTACTGG 0: 1
1: 0
2: 0
3: 4
4: 56
1191954147_1191954159 30 Left 1191954147 X:66625567-66625589 CCTTCCCTACCCACCATGGTAGC 0: 2
1: 74
2: 196
3: 190
4: 315
Right 1191954159 X:66625620-66625642 TCTAGGGCCCCGTGTACTACTGG 0: 1
1: 0
2: 0
3: 4
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191954159 Original CRISPR TCTAGGGCCCCGTGTACTAC TGG Intronic
904037112 1:27564893-27564915 TCTAGGGCCCCTCGTTTTACAGG + Intronic
914927195 1:151898543-151898565 TCTAGGGCCCCGCCCACCACCGG + Intronic
924302300 1:242652037-242652059 TCTAGGGCCCCACCTACCACTGG - Intergenic
1072561662 10:96581880-96581902 TCTGTGGCCCAGTGTACTTCTGG - Intronic
1075946832 10:126440495-126440517 TCTAGGGCCCTGCCTACTGCCGG + Intronic
1078100979 11:8330184-8330206 CCTAGGGCTCCGTGTCCCACAGG - Intergenic
1081566631 11:44264687-44264709 TCTGAGGCCCCGTGGACTGCTGG - Exonic
1083528514 11:63395744-63395766 TCTAGGGCCCCATTCACTGCTGG - Intronic
1086483228 11:87268012-87268034 TCTAGGGCACACTGTATTACAGG - Intronic
1089692685 11:120196685-120196707 TCTAGGTCCCTGTGAACTCCAGG - Intergenic
1091609850 12:1996719-1996741 TCTTGGGCCACGTGTCCTATGGG + Intronic
1095932102 12:47637296-47637318 TCTAGGGCCCCGCCCACTGCTGG + Intergenic
1096347909 12:50866586-50866608 TCTAGGGCCCTGTCCACCACTGG + Intronic
1103761083 12:123250872-123250894 TCTAGGGCCCCGCCCACTGCTGG - Intronic
1110561891 13:76918209-76918231 TCTAGGGCCCCGTCCACTGCCGG + Intergenic
1121465378 14:94112130-94112152 AATAGGGCCCCGTGTCCTATGGG + Intronic
1132636515 16:952467-952489 TCTGGGGCCACGTGCACTTCCGG - Intronic
1138797941 16:59993057-59993079 TCTAGGGCCCCGCCCACTGCTGG - Intergenic
1140750129 16:78015867-78015889 TCTAGGACCCAGTGTTCTCCTGG - Intergenic
1150538986 17:66076662-66076684 TCTAGGGCCACGTCCACCACTGG + Intronic
1164267480 19:23633086-23633108 TCTAGGGCTCCGCCTACTTCCGG + Intronic
1165974455 19:39662755-39662777 TCTGGGGCACCGTGCACTATAGG + Intergenic
928276664 2:29907133-29907155 TCTAGGGCCCTGTCTGCTTCTGG - Intronic
930019043 2:46990060-46990082 CCTAGGGCCCTGTGGCCTACAGG - Intronic
935247384 2:101230752-101230774 TCTAGGCCCCGGTGGACTTCTGG - Intronic
945132091 2:206584393-206584415 TCTAGGGCCCTGCCCACTACCGG - Intronic
946236317 2:218326665-218326687 TCTATGGCCCTGTGTCCTTCTGG + Intronic
1170493237 20:16899573-16899595 TCTAGGGCCCCCTGTACCTGAGG + Intergenic
1173599116 20:44280198-44280220 TCCATGGCACCGTGTAGTACAGG - Exonic
1175454865 20:59104786-59104808 TCCCGTGCCCCGTGTCCTACAGG - Intergenic
1177511491 21:22092491-22092513 TCTAAGGCTCCGTGTGCTAACGG - Intergenic
1180074987 21:45457639-45457661 TCAGGGGCCCCGTCTACTCCCGG - Intronic
1181890340 22:26057157-26057179 CCTAGGGCCCCTTGTTCTAAAGG + Intergenic
949604012 3:5634226-5634248 TCTAGGGCCCCGCCCACTGCCGG - Intergenic
950389256 3:12683588-12683610 TCTCGGGCCCTGTGAACTCCAGG - Intergenic
953563699 3:44013696-44013718 TCCAGGGCCCGGTGTGCTCCTGG - Intergenic
953723927 3:45381427-45381449 TCTAGGGCCCCGTCCACTGCCGG - Intergenic
961110258 3:124277537-124277559 TCTAAGTCACCGTGTTCTACAGG + Intronic
964601229 3:158503422-158503444 TCTAGGGCCCCGCCCACCACTGG - Intronic
965216857 3:165874756-165874778 TCTAGGGCCCTGCGCCCTACTGG - Intergenic
971183098 4:24349336-24349358 TCTAGGGCCCCGCCCACTGCTGG - Intergenic
977601517 4:98938549-98938571 TCTAGGGCCCCGAGTAGTGCAGG - Intergenic
981500528 4:145446438-145446460 TCTATGGCCCTGTCTAATACAGG - Intergenic
982075025 4:151730381-151730403 TCTAGGGCCCCGCCCACCACTGG + Intronic
984721719 4:182978564-182978586 TCTAGGGCCCCGCCCACCACCGG + Intergenic
992226622 5:74625247-74625269 GCTAAGGACCCCTGTACTACAGG - Intergenic
999142405 5:149371234-149371256 TCCAGGGCTCCGTGAACTGCTGG - Intergenic
1001450614 5:171821560-171821582 TCTAGCTCCCTGTGTACTAGTGG - Intergenic
1012793770 6:103734507-103734529 TCTAGGGCCCCGCTCACCACTGG + Intergenic
1034151996 7:148924300-148924322 TCTAGGGCCCAGTGTGCCAGAGG - Intergenic
1041585281 8:59509748-59509770 TCTATGGCCCTGTGTAATTCAGG - Intergenic
1042304111 8:67313796-67313818 TCTAGGGCCCTGTCTACTGCAGG - Intronic
1043472677 8:80578285-80578307 CCTAGGGCCCGGTGTCCCACGGG + Intergenic
1057119469 9:92558674-92558696 TCTAGGACCCCGCCTACTGCTGG - Intronic
1059609577 9:115878188-115878210 TCTAGGGCCCCGCCCACCACTGG - Intergenic
1187219167 X:17307607-17307629 TCTAGGGCCCCACCTACCACTGG - Intergenic
1187929188 X:24278355-24278377 TGTAGCGCCCCATGTATTACGGG - Intergenic
1191067595 X:56367024-56367046 TCTAGGGCCCTGCCTACCACTGG - Intergenic
1191954159 X:66625620-66625642 TCTAGGGCCCCGTGTACTACTGG + Intronic
1193420838 X:81280283-81280305 TCTAGGGCCCTGCCTACTGCGGG + Intronic
1195795484 X:108642343-108642365 TCTAGGGCCCCACCTACCACTGG + Intronic