ID: 1191955976

View in Genome Browser
Species Human (GRCh38)
Location X:66642665-66642687
Sequence CCTTTCATGAAGGAGCTTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191955972_1191955976 -5 Left 1191955972 X:66642647-66642669 CCAACAATGGCAGGACCACCTTT No data
Right 1191955976 X:66642665-66642687 CCTTTCATGAAGGAGCTTCATGG No data
1191955969_1191955976 11 Left 1191955969 X:66642631-66642653 CCTCTAATTCTAGTGTCCAACAA No data
Right 1191955976 X:66642665-66642687 CCTTTCATGAAGGAGCTTCATGG No data
1191955968_1191955976 20 Left 1191955968 X:66642622-66642644 CCTGGGTAGCCTCTAATTCTAGT No data
Right 1191955976 X:66642665-66642687 CCTTTCATGAAGGAGCTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191955976 Original CRISPR CCTTTCATGAAGGAGCTTCA TGG Intergenic
No off target data available for this crispr