ID: 1191956133

View in Genome Browser
Species Human (GRCh38)
Location X:66644250-66644272
Sequence GAATAGCTCTTCAGAGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191956133_1191956135 3 Left 1191956133 X:66644250-66644272 CCATCCTCTCTGAAGAGCTATTC No data
Right 1191956135 X:66644276-66644298 ACCTCTACCTTTAGAAGTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191956133 Original CRISPR GAATAGCTCTTCAGAGAGGA TGG (reversed) Intergenic
No off target data available for this crispr