ID: 1191965947

View in Genome Browser
Species Human (GRCh38)
Location X:66758290-66758312
Sequence TATATTTAAGCTGTGTCTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191965947_1191965949 28 Left 1191965947 X:66758290-66758312 CCTGAAGACACAGCTTAAATATA No data
Right 1191965949 X:66758341-66758363 AAGTGAGCCTATTCCATCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191965947 Original CRISPR TATATTTAAGCTGTGTCTTC AGG (reversed) Intergenic
No off target data available for this crispr