ID: 1191970492

View in Genome Browser
Species Human (GRCh38)
Location X:66809868-66809890
Sequence GAGTTTAAGGAGATGAAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191970492_1191970497 -8 Left 1191970492 X:66809868-66809890 CCTTGCTTCATCTCCTTAAACTC No data
Right 1191970497 X:66809883-66809905 TTAAACTCAGGGCTTGTTTAGGG No data
1191970492_1191970496 -9 Left 1191970492 X:66809868-66809890 CCTTGCTTCATCTCCTTAAACTC No data
Right 1191970496 X:66809882-66809904 CTTAAACTCAGGGCTTGTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191970492 Original CRISPR GAGTTTAAGGAGATGAAGCA AGG (reversed) Intergenic
No off target data available for this crispr