ID: 1191970496

View in Genome Browser
Species Human (GRCh38)
Location X:66809882-66809904
Sequence CTTAAACTCAGGGCTTGTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191970492_1191970496 -9 Left 1191970492 X:66809868-66809890 CCTTGCTTCATCTCCTTAAACTC No data
Right 1191970496 X:66809882-66809904 CTTAAACTCAGGGCTTGTTTAGG No data
1191970491_1191970496 17 Left 1191970491 X:66809842-66809864 CCTTCACTTAGGCAGTGGGGTAG No data
Right 1191970496 X:66809882-66809904 CTTAAACTCAGGGCTTGTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191970496 Original CRISPR CTTAAACTCAGGGCTTGTTT AGG Intergenic
No off target data available for this crispr