ID: 1191984332

View in Genome Browser
Species Human (GRCh38)
Location X:66962182-66962204
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 601
Summary {0: 2, 1: 2, 2: 4, 3: 64, 4: 529}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191984327_1191984332 -1 Left 1191984327 X:66962160-66962182 CCAGAGATGCTTTCTGCATTACT No data
Right 1191984332 X:66962182-66962204 TCTGCTGCTCCTGGGCAGTGGGG 0: 2
1: 2
2: 4
3: 64
4: 529
1191984326_1191984332 0 Left 1191984326 X:66962159-66962181 CCCAGAGATGCTTTCTGCATTAC No data
Right 1191984332 X:66962182-66962204 TCTGCTGCTCCTGGGCAGTGGGG 0: 2
1: 2
2: 4
3: 64
4: 529
1191984325_1191984332 9 Left 1191984325 X:66962150-66962172 CCTGCAGGGCCCAGAGATGCTTT No data
Right 1191984332 X:66962182-66962204 TCTGCTGCTCCTGGGCAGTGGGG 0: 2
1: 2
2: 4
3: 64
4: 529

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191984332 Original CRISPR TCTGCTGCTCCTGGGCAGTG GGG Intergenic
900386803 1:2414366-2414388 TCTGCTGTTCCTGGGCAGGTGGG + Intergenic
900500368 1:3001571-3001593 GCTGCTGCTCCAGGACAGGGTGG - Intergenic
900641831 1:3691249-3691271 TCTGATGCTCCTTGGCTTTGGGG + Intronic
901160711 1:7174802-7174824 TCTGCCTCGCCTGGGCCGTGGGG - Intronic
902108800 1:14060610-14060632 CAAGCTGCTCCAGGGCAGTGAGG - Intergenic
902294584 1:15457705-15457727 TTTGCTGCCTATGGGCAGTGGGG - Intronic
902404749 1:16176502-16176524 TCTGCCGCTCCAGGGGAGGGAGG + Intergenic
903182427 1:21611657-21611679 ACTTGTGCTCCTGGGCAGGGAGG - Intronic
903649352 1:24913575-24913597 TCTGATGCGTCTGTGCAGTGGGG + Intronic
904279829 1:29411113-29411135 TCTGCTACTCCCTGGCTGTGTGG - Intergenic
905257660 1:36695384-36695406 TCTGCTGCTTCCTGGCTGTGTGG + Intergenic
905394771 1:37660138-37660160 TGTTCTGCTCAAGGGCAGTGGGG + Intergenic
905742885 1:40387959-40387981 CCTGCTGGCCCTGGGCAATGAGG + Intronic
907647192 1:56255893-56255915 TCTGCTGCGTCAAGGCAGTGAGG + Intergenic
908080939 1:60577716-60577738 TCTGCTGCTCCTGAGGACTCAGG - Intergenic
908107634 1:60861499-60861521 CCTTCTGCTCCTGTGCTGTGAGG - Intergenic
908519376 1:64926388-64926410 TTTGTTCCACCTGGGCAGTGTGG - Intronic
909782294 1:79561779-79561801 ACTGCTGGCCCTGGGCAGTGAGG - Intergenic
909904573 1:81178861-81178883 CCTGCTGGCCCTGGGCAATGAGG - Intergenic
910710759 1:90177530-90177552 GCTGCTGCTCCTTGGTAGAGTGG - Intergenic
911765333 1:101667774-101667796 TCTGATGCTCCTGGGAACTCAGG + Intergenic
911954501 1:104217698-104217720 TCTGCTGGCCCCGGGCAATGTGG - Intergenic
912184147 1:107254416-107254438 GCGGCTGCTACTGGGAAGTGAGG - Intronic
912484202 1:110011709-110011731 TCAGCTGCTTCTGGGCAATCTGG - Intronic
913427901 1:118755304-118755326 CATGCTGCTACTGGGTAGTGTGG + Intergenic
914914852 1:151813337-151813359 TCCATTGCTCCTGGGCAGTGGGG + Exonic
915343174 1:155187191-155187213 TCTGCTTCCCCTGGCCTGTGGGG + Intronic
915354879 1:155250241-155250263 TCTCCTGAGCCTGGGCAGTCGGG + Intronic
915436589 1:155911261-155911283 GCTGCTCCTACTGGTCAGTGGGG + Intronic
915571044 1:156745180-156745202 TGTGCAGCTCAGGGGCAGTGAGG - Intronic
915607637 1:156963149-156963171 CCTGCTGGTACTGGGCAGAGAGG - Intronic
916131599 1:161616513-161616535 TCTGCCCCTTCTGGGAAGTGAGG - Intronic
916462968 1:165045947-165045969 TCTCCTCCTGCTGGGCTGTGTGG + Intergenic
916910118 1:169337331-169337353 CCTGCTGGCCCTGGGCAATGAGG - Intronic
917113510 1:171577582-171577604 TCTGTTGCTGCTGGGCAATAAGG - Exonic
917406330 1:174711504-174711526 GCTGCTGGCCCTGGGCAGTGAGG + Intronic
917445415 1:175102554-175102576 CCTGCTGGCCCCGGGCAGTGAGG - Intronic
917446370 1:175108711-175108733 CCTGCTGGCCCCGGGCAGTGAGG - Intronic
918512013 1:185321927-185321949 CCTGCCGGCCCTGGGCAGTGAGG - Intergenic
918659768 1:187074070-187074092 CCTGCTGGCCCCGGGCAGTGAGG - Intergenic
920074631 1:203327330-203327352 TCAGCTGCTCGTGGGGATTGAGG - Intergenic
920318424 1:205097270-205097292 ACTGCTGCTCCTGGCCTCTGGGG - Intronic
920542599 1:206790742-206790764 TAATCTGGTCCTGGGCAGTGGGG - Intergenic
921897091 1:220412538-220412560 CCTGCTGGCCCTGGGCAATGAGG + Intergenic
923640152 1:235749162-235749184 TCTTCTGTTTCTGAGCAGTGTGG - Intronic
923879806 1:238091336-238091358 TCTGCAGCTCCTCCGTAGTGGGG + Intergenic
923895694 1:238267363-238267385 TCTGCTGCTCCAAGCCAGTTTGG + Intergenic
1063119230 10:3093001-3093023 GCTCCTGCTCCTGGGATGTGTGG + Intronic
1063132553 10:3191005-3191027 TGTGCTGCTGCTGGGCTGTGTGG + Intergenic
1063300400 10:4845169-4845191 CCTGCTGGCCCTGGGCAATGAGG - Intronic
1063352720 10:5371628-5371650 TCTGCAGCTCCTCATCAGTGTGG - Intronic
1063584882 10:7343285-7343307 TCTGCTGTTGATGGGCATTGAGG + Intronic
1064505748 10:16027928-16027950 GCTGCTGCTGCTGGAGAGTGAGG - Intergenic
1065815658 10:29480423-29480445 TCTGCTGCGTCCGTGCAGTGGGG - Intronic
1065962637 10:30746501-30746523 TCACTTGCTCCTGGGAAGTGAGG - Intergenic
1066062899 10:31739893-31739915 TCTGGCCCTCCTGGGGAGTGTGG - Intergenic
1066186297 10:33013398-33013420 CCTGCTGGCCCCGGGCAGTGGGG + Intergenic
1066493996 10:35923199-35923221 ACTGTTGCTGCTGGGAAGTGGGG - Intergenic
1066567407 10:36734873-36734895 CCTGCTGGCCCTGGGCAATGGGG - Intergenic
1066613615 10:37275578-37275600 GCTGCCGGCCCTGGGCAGTGAGG - Intronic
1067038471 10:42935601-42935623 GCTGCTTCTCCTGGGCACCGAGG + Intergenic
1067173410 10:43925753-43925775 TGTGATGGTGCTGGGCAGTGGGG - Intergenic
1067213229 10:44279051-44279073 TCTGCTGCTCCCAGGCTCTGGGG + Intergenic
1067302604 10:45026101-45026123 TCCTCTGCTCCTGTGCTGTGTGG - Intergenic
1067843065 10:49697340-49697362 TCTCTTGCTTCTGGGCAGGGAGG - Intronic
1067968478 10:50941801-50941823 TCTGCTCCCCCTGGGCAGCAGGG - Intergenic
1068554967 10:58448510-58448532 GCCGCAGGTCCTGGGCAGTGAGG - Intergenic
1068820976 10:61377125-61377147 ACTGCCGGCCCTGGGCAGTGAGG - Intergenic
1069618962 10:69824575-69824597 CCCACTGGTCCTGGGCAGTGAGG + Intronic
1070599081 10:77853353-77853375 CCTGCTGCTGCTGGGCACGGAGG + Exonic
1070772440 10:79090244-79090266 TGTGGTGCCCCTGAGCAGTGGGG + Intronic
1070979757 10:80634591-80634613 GCTGCTGGCTCTGGGCAGTGGGG + Intronic
1071166996 10:82818244-82818266 TCTTATGCTGATGGGCAGTGAGG + Intronic
1071387997 10:85141506-85141528 CCTGCTGGCCCCGGGCAGTGAGG + Intergenic
1072039045 10:91590432-91590454 GCTGCTGCTCCGGGGAAGGGCGG - Intergenic
1072197958 10:93132825-93132847 TCTCCTGCTCTTGGGTAGGGAGG + Intergenic
1072619917 10:97073195-97073217 TCTTCTGCCCCTGGTCTGTGTGG + Intronic
1073051715 10:100671310-100671332 GCTGCTCCTGCTGGGCAGAGGGG - Intergenic
1074270798 10:111951662-111951684 GCTACTGCTCCTGTGCCGTGAGG - Intergenic
1074531600 10:114302212-114302234 TTTCCTGCTGCTGGGCAGAGTGG + Intronic
1075357353 10:121792492-121792514 TCTACTGCTGTAGGGCAGTGAGG - Intronic
1076339044 10:129729960-129729982 TCTGCTGGGCGTGGACAGTGGGG + Intronic
1076449251 10:130545005-130545027 TCTCCTCCTCCTGTGCAGTGTGG + Intergenic
1076839513 10:133039156-133039178 GCTGCTGCTCCAGGTCAGAGGGG - Intergenic
1077168996 11:1158095-1158117 TCTACTGGTCCTGGGTGGTGCGG + Intronic
1077231783 11:1461061-1461083 GCTGTTGCTGCCGGGCAGTGAGG + Exonic
1077252674 11:1567506-1567528 GCTGGGGCTCCTGGGCAGGGAGG - Intronic
1077269310 11:1667624-1667646 TCTGCAGCTTCTGAGCACTGAGG - Intergenic
1077646738 11:3932029-3932051 CCTGTTGCTCCTGGGCTGTGTGG + Intronic
1078301205 11:10133558-10133580 CCTGCTGGCCCTGGGCAATGGGG - Intronic
1078547264 11:12255503-12255525 TTTGCTTCTCCTGGGTCGTGGGG + Intronic
1078591398 11:12643176-12643198 TCTGCTCCGCCTGGGCTGGGAGG + Intergenic
1078795814 11:14591168-14591190 CCTGCCGGCCCTGGGCAGTGAGG + Intronic
1078861341 11:15249896-15249918 TGTGCTGCACCTGACCAGTGAGG - Intergenic
1079064079 11:17274680-17274702 TCTGCTGCTGCCGGGTACTGCGG + Intronic
1079242432 11:18729960-18729982 TCTGGTGCCACTGGGCAATGTGG - Intronic
1079259234 11:18862104-18862126 TGTGCTGCTCACAGGCAGTGAGG - Intergenic
1079269462 11:18970280-18970302 TGTGCTGCTCTTAGACAGTGAGG - Intergenic
1081136159 11:39442316-39442338 ACCGCTGGCCCTGGGCAGTGAGG - Intergenic
1081613357 11:44576641-44576663 TCTGCTGCTGCCTGGCTGTGTGG + Intronic
1081716562 11:45254735-45254757 TATGCTGCTGCTGGGCACTGGGG - Intronic
1081892505 11:46555584-46555606 TCTGCTACTCTTGGGAATTGTGG - Intronic
1083150870 11:60790994-60791016 TCTGCTGCACCTGGTCTTTGGGG + Exonic
1084536402 11:69759866-69759888 TCTCCTGCTACAGGCCAGTGTGG - Intergenic
1084660660 11:70544621-70544643 TCTGCTGGTCCAGGCCAGGGAGG - Intronic
1084685887 11:70694966-70694988 TCTGCTGGTCCTGGGCAGGGTGG + Intronic
1085121459 11:73970066-73970088 TCTGCTTCTTCTGGGGTGTGAGG - Exonic
1085645938 11:78222933-78222955 CCTGCTGCTCCTGGCCAGGTCGG + Intronic
1087036127 11:93758343-93758365 GCAGCTGCGCCTGGGCAGTTGGG - Intronic
1089560342 11:119340358-119340380 CCTGCTGCTCCTGGGCCTGGCGG - Exonic
1089574701 11:119433184-119433206 TCTGCTGCTCCTTGGCAGGAAGG + Intergenic
1089642321 11:119855988-119856010 TCTGGTGCTCTGGGGCAGTGTGG + Intergenic
1089910028 11:122088706-122088728 CCGGCTGCCCCTTGGCAGTGTGG + Intergenic
1090307691 11:125704956-125704978 CCTGCTGGCCCTGGGCAATGAGG - Intergenic
1090703505 11:129316380-129316402 TCTGCAGCTCCAGGGCAAAGGGG - Intergenic
1091180063 11:133596291-133596313 TCTGCAGCTCCTGCTCAGAGTGG - Intergenic
1091398240 12:167347-167369 TGTGCTGCTCCTGGGCTGATGGG - Intronic
1091671264 12:2453806-2453828 TGTCCTGCTGCTGGGCAGGGTGG - Intronic
1092158442 12:6300818-6300840 TTTGCTGCTTATGGGCTGTGTGG - Intergenic
1092756245 12:11766137-11766159 TCTGCTGCTGCTGGGATGTGTGG - Intronic
1092926286 12:13275401-13275423 GCTGCTGCTCCTGGGCACAGAGG - Intergenic
1093527096 12:20115483-20115505 CCTGCGGGCCCTGGGCAGTGAGG - Intergenic
1095133511 12:38571227-38571249 TCTGCTGCTGCTGGGCAGTGGGG - Intergenic
1095444962 12:42273956-42273978 CCTGCTGGTCCTGGGCAGCAAGG - Intronic
1095906756 12:47386034-47386056 CCTGCTTCTCCTGGTGAGTGGGG - Intergenic
1096094494 12:48925368-48925390 GCTGCTGCTGCTGCTCAGTGCGG - Exonic
1096272568 12:50177860-50177882 TCTTCTACCCCTGGGCTGTGAGG + Exonic
1099790704 12:87330322-87330344 CCTGCTGGCCCCGGGCAGTGAGG + Intergenic
1100584690 12:95969241-95969263 CCTGCTGGCCCCGGGCAGTGAGG + Intergenic
1101406789 12:104435844-104435866 GCTGCAGCTCCTGGGCAAGGTGG - Intergenic
1103864975 12:124044438-124044460 TCAGCTGCTGCTGGACAGAGGGG + Intronic
1104119296 12:125783750-125783772 TGTGCTGCTCCTGGGCTCTGTGG - Intergenic
1104612145 12:130237479-130237501 TCTGCGGCTCATGGGAAGGGTGG - Intergenic
1104981143 12:132573604-132573626 ACAGCTGCTTCTGGGCAGGGTGG + Intronic
1105443245 13:20432362-20432384 TCTGCTGCTCCTGACCATTCAGG - Intronic
1106083333 13:26518639-26518661 GCTGCTGCTCCTGGGGAGAAAGG - Intergenic
1108858968 13:54829754-54829776 CCTGCTGGCCCTGGGCAATGAGG - Intergenic
1109888654 13:68577851-68577873 TCTGTTGAACCTGGGCAGTGGGG - Intergenic
1111591015 13:90348705-90348727 CCTGCTGGCCCTGGGCAATGAGG + Intergenic
1112085973 13:96033403-96033425 ACAGCTGCACCTGGGGAGTGCGG - Intronic
1112466654 13:99651097-99651119 TCTGCTGGCCCACGGCAGTGTGG - Intronic
1113047283 13:106169658-106169680 GCAGCTGCTCCTGAGCAATGTGG + Intergenic
1113584818 13:111458010-111458032 TCTGCTGCTCCCCAGCTGTGTGG + Intergenic
1113791999 13:113033888-113033910 TCTGCTGCTTCTGAGCACTGGGG + Intronic
1113850819 13:113416964-113416986 GCTGCTGATCCTGGGCAAAGGGG + Intergenic
1114593526 14:23891863-23891885 CCTGCTGGCCCTGGGCAATGAGG + Intergenic
1114738795 14:25071869-25071891 TCTGTTGGTCCAGGGCAGTTTGG - Intergenic
1115992815 14:39167001-39167023 TCAGCTCTACCTGGGCAGTGGGG + Intronic
1116932317 14:50702627-50702649 TCTGGTGATCCTGCCCAGTGAGG + Intergenic
1117082582 14:52166853-52166875 GCTGCCGGCCCTGGGCAGTGAGG + Intergenic
1118819209 14:69334197-69334219 GCTGCTGCTTCAGGGCAGGGAGG - Intronic
1119650835 14:76381649-76381671 TCTGGTGCTCCTGGGCTCAGCGG + Intronic
1121135076 14:91490050-91490072 TCTGCATCTTCTGGGCAATGAGG + Intronic
1121681334 14:95795065-95795087 GCTGCTCCTCCTGGGGAGTGGGG + Intergenic
1122499631 14:102188183-102188205 TCAGATGCTTCTGGGCACTGAGG + Intronic
1122922965 14:104887503-104887525 TCTGCTCCTCCCGGGCAGCTGGG - Exonic
1122946678 14:105014185-105014207 CCTTCTGCTCCTGGGCTGTGGGG + Intronic
1123036454 14:105473882-105473904 GCAGCTGGTCCTGGGCGGTGCGG + Intronic
1124573120 15:30883863-30883885 CCTGCTGGCCCCGGGCAGTGGGG + Intergenic
1125501070 15:40240655-40240677 GCTGCTCCTTCTGGGCAGCGGGG - Exonic
1125542257 15:40476370-40476392 TGTGATGCTCCTGGGGTGTGGGG - Intergenic
1126609605 15:50515880-50515902 TCTCCTGTTGCTGGGCAGTTAGG - Intronic
1127629442 15:60813235-60813257 TCTGCTCTTCCTGGGCAGAGAGG - Intronic
1127901772 15:63346303-63346325 TGTGCTTCTTCTGGGAAGTGCGG + Intronic
1127916438 15:63459192-63459214 GCTGCTGGCCCTGGGCAGTAAGG + Intergenic
1128558112 15:68645386-68645408 GCTGCAGCTCCAGGGCAGAGAGG + Intronic
1129125617 15:73438410-73438432 TCTGCTGCTTCTAGTCAGCGAGG + Intergenic
1129174551 15:73830537-73830559 TCTGCAGCAGCTGGGCAATGAGG - Intergenic
1129467323 15:75731404-75731426 TTTACTACTCCAGGGCAGTGAGG - Intergenic
1129665287 15:77576216-77576238 CCTGCTCCTCCCTGGCAGTGAGG - Intergenic
1129859158 15:78846980-78847002 CCTGCTGGTCCTGGGCAATGAGG + Intronic
1130231556 15:82101143-82101165 TCTGCCCCTTCTGGGAAGTGTGG - Intergenic
1130623732 15:85491329-85491351 TCTGCTGACCCTGGGCAGATGGG + Intronic
1131507778 15:93031934-93031956 TCTGCTGGCCCCGGGCAATGAGG + Intergenic
1132294899 15:100727633-100727655 TCTGCTCCTCCGGGGCAGGCAGG + Intergenic
1132301061 15:100775819-100775841 TCAGCTGCTCCGTGGCAGAGCGG + Intergenic
1132331099 15:101013040-101013062 TTTGCTGCTTCTGGGCTTTGGGG - Intronic
1133303145 16:4795327-4795349 TCTGCTGGCCCTGGGGAGGGCGG + Intronic
1133783875 16:8960525-8960547 CCTGCACCTCCTGGGCAGAGTGG - Intronic
1133857558 16:9564036-9564058 TCAGCTGGTGCTGGGCAGAGTGG - Intergenic
1135299401 16:21313034-21313056 CCTGCTGGCCCCGGGCAGTGAGG - Intergenic
1135949324 16:26898495-26898517 TCTGCTGCTGCTGTGCACTGTGG + Intergenic
1135983305 16:27165539-27165561 ATTGCTGCTTCTGGCCAGTGTGG - Intergenic
1137380623 16:47995632-47995654 TCAGCTCCTGCTGGGTAGTGTGG - Intergenic
1137548700 16:49421941-49421963 TCTGCTGCTGCTGGCCCATGTGG - Intergenic
1137581452 16:49635968-49635990 TCTGCAGCCCCTGGCCATTGGGG + Exonic
1138678819 16:58670698-58670720 TCTGCTGCTCCTTGACTATGAGG - Intronic
1139339584 16:66259383-66259405 GCAGCTGCTCCTGGGCTCTGGGG - Intergenic
1139464067 16:67144746-67144768 TCTGTTTCTCCTGGGGTGTGGGG + Intronic
1139576084 16:67842974-67842996 TCGGCTGCAGCTGGGCAGTCTGG - Exonic
1139752321 16:69116700-69116722 TCTGCTGCTTTTGGGGAATGAGG + Exonic
1139922913 16:70470958-70470980 GCTGCTGCTCCTGTGCAGCCAGG - Exonic
1140145247 16:72300486-72300508 TCTGCTGCTTGTCAGCAGTGGGG + Intergenic
1141777713 16:86135295-86135317 TCTGCTCTTCCTGGGCGGTGTGG + Intergenic
1141837697 16:86553517-86553539 GCGGCTGGCCCTGGGCAGTGAGG + Intronic
1142110039 16:88326496-88326518 TCTGCTGCTCCTGGGCCTCGGGG + Intergenic
1142133400 16:88441123-88441145 TCTGTTCCTCCTGGGGGGTGAGG - Intergenic
1142285435 16:89169729-89169751 TCTGGAGGTCCTGTGCAGTGGGG - Intergenic
1142513090 17:410310-410332 CCTGCTGCGCCTGCGCAGTCAGG - Exonic
1142687020 17:1583236-1583258 CCTGCTGCTCGTGGGCTTTGGGG - Exonic
1142718843 17:1763011-1763033 GCTGCTGCTTCTGGGGTGTGGGG + Intronic
1143677672 17:8447926-8447948 GCTGCTGCTCCAGGGCATAGAGG + Intronic
1143728966 17:8869494-8869516 TCAGCAGCAGCTGGGCAGTGTGG + Intergenic
1143779415 17:9221511-9221533 TCTGCCGCTGATGGGCTGTGTGG + Intronic
1143920954 17:10330689-10330711 GTGGCTCCTCCTGGGCAGTGAGG + Intronic
1144293453 17:13849930-13849952 TCTGTTGTACCTGGGCAGAGAGG - Intergenic
1144362348 17:14507541-14507563 TCTGCTGCTGTAGGGCAGCGAGG + Intergenic
1144719995 17:17462566-17462588 TATGATGCTCCTGGGCTCTGTGG + Intergenic
1144888950 17:18483073-18483095 TCTGCTGCTCCTGACCTGAGTGG - Intronic
1144957441 17:19026119-19026141 TTTGCTCCTCCTGGGCCGTGAGG - Intronic
1144977715 17:19148397-19148419 TTTGCTCCTCCTGGGCCGTGAGG + Intronic
1145003491 17:19321731-19321753 GCTGCTGAGCATGGGCAGTGAGG + Intronic
1145143258 17:20461223-20461245 TCTGCTGCTCCTGACCTGAGTGG + Intronic
1145992357 17:29086715-29086737 TCTGTTGCTGCTGGGCTGTGGGG + Intronic
1146470135 17:33117566-33117588 TCTGCTACCCCTTGGCACTGTGG - Intronic
1146512200 17:33459746-33459768 GCTGCTGCTCCTGGGCTGGCAGG - Intronic
1146633841 17:34489752-34489774 ACTGGAGCTTCTGGGCAGTGGGG + Intergenic
1147539641 17:41346539-41346561 TCTGCCGCTCCAGGTCACTGCGG + Exonic
1147541591 17:41364870-41364892 TCTGCCGCTCCAGGTCACTGCGG + Exonic
1147545068 17:41394939-41394961 TCTGCCGCTCCAGGTCACTGCGG + Exonic
1148118872 17:45195736-45195758 TCTGCTGCTGCTGGACATTTGGG + Intergenic
1148475630 17:47926915-47926937 GCTCCGGCTCCTGGCCAGTGTGG + Intronic
1148612129 17:48971591-48971613 TCTGCTGCTTCTGGGGAGTGTGG - Intergenic
1150895509 17:69205761-69205783 ACTTGTGCTTCTGGGCAGTGGGG + Intronic
1151046265 17:70923072-70923094 TCAGCTACTCCTGGGCTGGGAGG + Intergenic
1151451473 17:74200719-74200741 TCTGCTGGCTCTGGGCAGAGAGG - Intergenic
1151540913 17:74764109-74764131 GCTGCTGCACCGGGGCAGGGAGG + Intronic
1151563710 17:74885133-74885155 GCTGCTGCTACTGCACAGTGAGG - Intronic
1151751860 17:76043672-76043694 CCTGCAGCTCCTGGGCAGTCAGG + Intronic
1152008584 17:77697145-77697167 TGTGCTGCCCCGGGGCAGTGAGG + Intergenic
1152498188 17:80689422-80689444 TCTGCTGAGTGTGGGCAGTGAGG + Intronic
1152595736 17:81236792-81236814 TCTTCAGCACCTGGGGAGTGGGG + Exonic
1152615819 17:81337295-81337317 GCTCCTGCACCTGGGCACTGGGG + Intergenic
1152626767 17:81391271-81391293 TCTGCTGCTCTTGGGGAGCGTGG + Intergenic
1153104523 18:1511390-1511412 CCTGCTGCTGCTGGGCGGGGAGG + Intergenic
1153419364 18:4886598-4886620 TCTGCAGCTCCTGGGGAGATTGG - Intergenic
1154290159 18:13099356-13099378 TCTGCTCTTCCTGAGCAGTGAGG + Intronic
1154342673 18:13517259-13517281 TCTGCTGGAACTGGGTAGTGGGG - Intronic
1154410798 18:14141155-14141177 TCTGCTGCTCATGGCCAGGCTGG - Intergenic
1155699884 18:28730968-28730990 TCTTCTGCTCCTGGGTAGGATGG - Intergenic
1155772867 18:29723624-29723646 CCTGCTGGCCCCGGGCAGTGGGG + Intergenic
1156150340 18:34234064-34234086 CCCGCTGGTCCTGGGCAGTGAGG + Intergenic
1156450931 18:37266203-37266225 CCTGGTGCTCCTGGGCAAAGTGG + Intronic
1157578439 18:48759185-48759207 TGTGCCCCTGCTGGGCAGTGGGG - Intronic
1157856904 18:51112059-51112081 CCTGCTGGCCCTGGGCAGTGAGG - Intergenic
1158382080 18:56942413-56942435 TCTGGTGCTACTGGGCTGTCTGG + Intronic
1159015862 18:63101318-63101340 GCTGCAGCTCCTGGGCACAGCGG + Intergenic
1159028413 18:63207517-63207539 TCTGGTGCTCCCAGGCAGTCTGG - Intronic
1159028418 18:63207551-63207573 TCTGGTGCTCCCAGGCAGTCTGG - Intronic
1159028423 18:63207585-63207607 TCTGGTGCTCCCAGGCAGTCTGG - Intronic
1159893716 18:73977227-73977249 GCTGCTGCTGCTGGACTGTGAGG - Intergenic
1160263969 18:77322749-77322771 TCTCCTGCTCCTTGGCGATGAGG - Intergenic
1160622007 18:80178341-80178363 TCCGCTGCTGCTGGGCTGAGGGG + Intronic
1160892734 19:1387804-1387826 TCTGCAGCTCCTGGCCTGCGCGG + Exonic
1160979519 19:1810600-1810622 GGTGCTGATCCTGGGCAGAGGGG - Exonic
1161466225 19:4432146-4432168 TCTGCTCCTCCTGGGCCGGCAGG - Exonic
1161731361 19:5962835-5962857 TCTGGTGGTCGGGGGCAGTGGGG - Intronic
1161993538 19:7698735-7698757 TCTGCTTCTCCTGTGGCGTGAGG - Exonic
1162440278 19:10688253-10688275 TCAGCTGCTGCTGGGAAGTTTGG + Intronic
1162450169 19:10749607-10749629 TCCGCCCCTCCTGGGCTGTGTGG - Intronic
1162488537 19:10977235-10977257 TCTGTTGTTCCTGAGCATTGCGG + Intronic
1162632711 19:11941549-11941571 CCTGCTGGCCCTGGGCAATGAGG - Intronic
1162914121 19:13865319-13865341 TCGGCGGCTCCGGGGCAGGGCGG - Intronic
1162987093 19:14277732-14277754 GCTGCCGGCCCTGGGCAGTGAGG + Intergenic
1163138937 19:15332991-15333013 TTGGCTGCCCCTGGGCAGGGAGG + Intergenic
1163155912 19:15439883-15439905 GGTGCTGCTCCAGGGCAGTGGGG + Intronic
1164186096 19:22871406-22871428 GCTGCCCCTACTGGGCAGTGAGG - Intergenic
1164664022 19:30011186-30011208 TCGGCAGCTCCTGGGCAGAGTGG - Exonic
1164704284 19:30308530-30308552 TTTGTTGCTCCAGGGCAGTGAGG + Intronic
1165095321 19:33406935-33406957 TGTGTTGCTCCTGGGCATGGGGG - Intronic
1165152184 19:33767267-33767289 TCCATGGCTCCTGGGCAGTGGGG + Intronic
1165798712 19:38534707-38534729 TCTGTTTCTCCTGGGAAGGGAGG - Exonic
1166955268 19:46460012-46460034 TCTGCTGCGGCTGTGCACTGCGG - Intergenic
1167050477 19:47075015-47075037 CTTGCTGTTCCTGGGCAGAGGGG - Intronic
1167082916 19:47289602-47289624 TCTGCTGCAGCTGTGCACTGAGG - Intergenic
1168256040 19:55165920-55165942 TGTGCTGCTTCTGGGCTCTGTGG - Exonic
1168413653 19:56155586-56155608 GATGCTGCTGCTGTGCAGTGAGG - Intronic
926564429 2:14454263-14454285 TCTTATGCTAATGGGCAGTGAGG - Intergenic
927152519 2:20204079-20204101 CCTCCTGCTCCCGGGCGGTGAGG + Exonic
928313630 2:30230638-30230660 GCTGCAATTCCTGGGCAGTGTGG + Intergenic
928753186 2:34494400-34494422 CCTGCTGACCCCGGGCAGTGGGG + Intergenic
929607358 2:43243608-43243630 TCACCAGCTCCTGGGCAGAGAGG + Intronic
929925860 2:46207939-46207961 CCTGCTGCACCTGGGCTGTCTGG + Intergenic
929969563 2:46562275-46562297 TCTCTTTCTCCAGGGCAGTGAGG - Intronic
930411212 2:51028201-51028223 GCTGCTGCTCCTGGGCTGCTGGG - Exonic
931191367 2:60003470-60003492 TCTTCTGCTCCATGGGAGTGGGG - Intergenic
931228359 2:60352943-60352965 TGTGCTGCACCTGGTCCGTGAGG - Intergenic
931522940 2:63119214-63119236 TCAGCTGCTTGAGGGCAGTGTGG + Intergenic
931895475 2:66724395-66724417 TTTGCTGCTCTTCGGCACTGTGG + Intergenic
932476350 2:72008761-72008783 CCTGGTGCTCCCGAGCAGTGAGG - Intergenic
933573533 2:84040801-84040823 TCTGCTGGTTCTTCGCAGTGGGG - Intergenic
933725923 2:85427225-85427247 TCAGGTGCTGCTGGACAGTGGGG + Intronic
934617677 2:95785031-95785053 TCTCCTGCTCCTGGGAGGGGTGG - Intergenic
934643216 2:96039528-96039550 TCTCCTGCTCCTGGGAGGGGTGG + Intergenic
934712415 2:96524800-96524822 TCTGCTGCCCTCGGGCAGTTAGG - Intergenic
934736158 2:96690931-96690953 TTTGCTGCTTATGGGCTGTGTGG + Intergenic
934768351 2:96893190-96893212 TCTGCTGCCCCTGGGGACTCGGG - Intronic
937620381 2:123978625-123978647 CCTGGTGCTCCTGGGCAGGTGGG - Intergenic
938118131 2:128615889-128615911 TCTGCTGCACCCGGGAACTGTGG + Intergenic
938703401 2:133898930-133898952 TCTGCAACCCCTGGGAAGTGGGG + Intergenic
938726039 2:134109599-134109621 CCTGCTGGCCCTGGGCAATGAGG - Intergenic
938953416 2:136278032-136278054 TCTTCTGTTCCTGGGCAATAAGG + Intergenic
939702562 2:145411771-145411793 TCCCGTGCTCCTGGGCATTGGGG + Intergenic
939733173 2:145810570-145810592 TGTACTGCACTTGGGCAGTGAGG + Intergenic
939777365 2:146403945-146403967 CCTGCTGGCCCTGGGCAATGAGG - Intergenic
942246418 2:174012920-174012942 TCTGCCGCTCCTCCGCCGTGGGG + Intergenic
943942713 2:194020268-194020290 CCCGCTGGCCCTGGGCAGTGAGG + Intergenic
944688608 2:202139690-202139712 TCTGCAGCTCCTTGGCAGCAGGG - Intronic
945312173 2:208326446-208326468 TCTGATGCTCCTGTGCATTTAGG + Intronic
945451493 2:210000827-210000849 CCTGCTGGCCCCGGGCAGTGAGG - Intergenic
945944318 2:215980293-215980315 TCTGGGGCTCCAGGGCAGTGAGG + Intronic
946152779 2:217787519-217787541 GCCGCTGGCCCTGGGCAGTGGGG - Intergenic
948356378 2:237381092-237381114 TCTTCAGCTCCTGGGCAGGCTGG + Exonic
948424066 2:237876834-237876856 CCTGCAGCTCCTGGGCTGGGGGG + Intronic
948583584 2:239004446-239004468 TCTGCAGCTCCTGGCAGGTGCGG - Intergenic
948660478 2:239503535-239503557 TCTGGGGTTCCTGGGCTGTGGGG - Intergenic
948682647 2:239646398-239646420 TCTCCAGCTCCCGGGCTGTGCGG + Intergenic
948763809 2:240209294-240209316 TTTGCTCCACCTGTGCAGTGAGG - Intergenic
948791025 2:240376909-240376931 GCTGCTGCTCCCGGGCAGTCTGG + Intergenic
948804300 2:240446861-240446883 TGGGCAGCCCCTGGGCAGTGTGG + Intronic
1169839696 20:9921436-9921458 TCTGATGCTCTAGGGCAGTGTGG - Intergenic
1170332056 20:15223991-15224013 TCTGAGGCTGCTGTGCAGTGAGG + Intronic
1171227015 20:23450311-23450333 TCTGCTGGGCCAGGGCAGTTTGG - Intergenic
1173246933 20:41343319-41343341 TCTGCTTTTCCTGGGCACAGTGG + Intronic
1173457857 20:43217756-43217778 TTTGCTGCTTCTGGGCAGGCTGG - Intergenic
1173584755 20:44174223-44174245 TGAGCTACTCCTGGGCTGTGTGG - Intronic
1173944722 20:46941379-46941401 TCTTCTGCTCCTCAGCTGTGTGG + Intronic
1174117674 20:48238457-48238479 TGTGCTGCTCCTCGGGGGTGAGG - Intergenic
1175254143 20:57628901-57628923 CCTGCTGGCCCTGGGCAATGAGG + Intergenic
1175273808 20:57753883-57753905 TGTGCTGCTCTCAGGCAGTGTGG + Intergenic
1175401158 20:58700857-58700879 TCTCCTGCCCCTGGCCAGTGTGG - Intronic
1175547446 20:59787658-59787680 TCTCCAGCTCCTGGCCAGAGGGG - Intronic
1175822145 20:61915793-61915815 TCTCCTGCACCTTGGCCGTGGGG + Intronic
1176033326 20:63024347-63024369 TCCGCTGCTCCGTGGCGGTGGGG + Intergenic
1176172490 20:63702252-63702274 TCTGCTGGCCCTTGGCAGGGTGG - Intronic
1176412189 21:6455065-6455087 TCTGCTGCTCCGCCGCAGGGTGG - Intergenic
1176862260 21:14017264-14017286 TCTGCTGCTCATGGCCAGGCTGG + Intergenic
1177975793 21:27849003-27849025 TCTGCTGCTGATGGGCACTTAGG - Intergenic
1178424405 21:32467813-32467835 TCTGCTCCTCCAAGGCAGAGCGG + Exonic
1179687683 21:43063387-43063409 TCTGCTGCTCCGCCGCAGGGTGG - Intronic
1179899269 21:44380590-44380612 GCTGATGCTCCTGCTCAGTGGGG + Intronic
1179908774 21:44437271-44437293 CCTGCAGCCCCTGGGCAGGGAGG + Intronic
1180131728 21:45830972-45830994 GCTGCTCCGCCTGGGCAGCGTGG - Intronic
1180132462 21:45835364-45835386 TCTGGTGCTCCTGTGCACGGGGG + Intronic
1181267115 22:21636824-21636846 TGGCCTGGTCCTGGGCAGTGTGG - Exonic
1181383309 22:22524513-22524535 ACTGCTGCTGCTGGGGACTGGGG + Intergenic
1181470913 22:23139057-23139079 TCTGCTGCTTTGGGGCACTGGGG + Intronic
1182168495 22:28202048-28202070 TCTGCTGCTTCTGTGAAATGAGG - Intronic
1182288887 22:29264138-29264160 CCTGCTGCTCCTGCCCACTGTGG - Exonic
1182478068 22:30587534-30587556 TTTGCTCATCCTGGGCAGAGGGG - Intronic
1183271723 22:36866453-36866475 TCTGCTGCTCCTTGGAAGGTGGG + Intronic
1183280671 22:36930429-36930451 TCAGCTGCTCCTGGGAGGTGAGG + Exonic
1183318876 22:37152846-37152868 GCTGCTGCTTCTGGGCTCTGAGG - Intronic
1183324250 22:37182959-37182981 TCTTCTGCTCCTGCACTGTGTGG - Intronic
1183381429 22:37492314-37492336 TCTGCTGCTCACTGGCAGGGCGG - Intronic
1183541036 22:38429585-38429607 TCACCAGCTCCTGGGAAGTGTGG - Intronic
1183704422 22:39468239-39468261 CCTGCAGCTCCTGGGCAGGAGGG - Intronic
1184288225 22:43483909-43483931 CCTGCTGCCCGTGGCCAGTGGGG + Intronic
1184676375 22:46045401-46045423 TGTGCTGCCCCTGGGCAGCCTGG - Intergenic
1184923967 22:47624654-47624676 TCTGCGCCTCCTGAGCAGTTCGG + Intergenic
1185041025 22:48504479-48504501 TCTTTTCCTCCTGGGCAGTTGGG + Intronic
1185062691 22:48615380-48615402 TCTTCAAGTCCTGGGCAGTGGGG + Intronic
1185153331 22:49178853-49178875 TCTCCTGCCTCTGTGCAGTGTGG + Intergenic
1185315835 22:50178742-50178764 ACTGCGGCTCCGGGACAGTGGGG + Intronic
1185367447 22:50443412-50443434 TCTGCTGCTCGTGGCCAGGCTGG + Intronic
950580870 3:13861290-13861312 TCCTCTGCTCCTGGGCAGGAGGG - Intronic
950808860 3:15632389-15632411 TCTGCTGTTCCCTGGAAGTGGGG + Intronic
952423587 3:33152855-33152877 ACTGCTGCTCCTGGCAGGTGTGG - Exonic
954411452 3:50372973-50372995 TTGGCTGGTCCTGGGCAGGGAGG + Intronic
954763035 3:52890862-52890884 TCTGCTGCTCTGGGGTAGGGCGG + Intronic
954921623 3:54195828-54195850 TCTGCTGCTCATGAGGGGTGTGG - Intronic
955219654 3:57012972-57012994 CCTGCTGGCCCTGGGCAGTGAGG + Intronic
956327274 3:68067846-68067868 TCTACTACTCCTGGACAGTAGGG - Intronic
956426353 3:69139681-69139703 TCTGCTGCCACTGGGCTGTGTGG + Intergenic
958730916 3:97959188-97959210 TCTGATGCTCCTGGGCCTTGTGG - Intronic
959462445 3:106643877-106643899 GCTGCTGGCCCTGGGCAGTGAGG + Intergenic
961298223 3:125904040-125904062 TCCGCCGGCCCTGGGCAGTGAGG + Intergenic
961460454 3:127046784-127046806 CCTGCTGGCCCTGGGCAATGAGG + Intergenic
961535912 3:127570419-127570441 TCTGCTGCTTCAGGGCCATGTGG + Intergenic
962403909 3:135083918-135083940 TCACCTGCTCCTGGGAAGGGAGG - Intronic
963397871 3:144756989-144757011 GCCGCTGGCCCTGGGCAGTGAGG + Intergenic
965665299 3:171087422-171087444 TCTGCTGCACCAGGTCAGGGAGG + Exonic
966762636 3:183430845-183430867 ACTGCTTCCCCTGGGCAGTAAGG + Intergenic
968445521 4:650364-650386 TCTGCCTGTCCTGGGCAGTGGGG - Intronic
968469676 4:773673-773695 TCTGCTGGCCCCGGGCAGTGAGG + Intergenic
968613179 4:1566279-1566301 CCTGGTGCTCCTGGGCACCGTGG - Intergenic
968636865 4:1685140-1685162 TGTGCTGGCCCTGGGCTGTGTGG + Intergenic
968703171 4:2066218-2066240 TCTGAGAGTCCTGGGCAGTGTGG + Exonic
970268931 4:14321914-14321936 TCTGCTGCTGCTGAGCCCTGAGG - Intergenic
970300901 4:14680568-14680590 TCTGCTGCTCTGGAGCTGTGTGG - Intergenic
970831186 4:20341519-20341541 CCTGCTGCTCCTGGTTCGTGTGG - Intronic
972412607 4:38808119-38808141 GCTGCTCCTACTGGGAAGTGAGG + Intronic
972505791 4:39718755-39718777 CCTGCTGGCCCTGGGCAGTGAGG - Intronic
975377414 4:73661789-73661811 TCTGCAGCTCTTGGTAAGTGAGG + Intergenic
975664779 4:76724818-76724840 TCTGCTGCTAATGGGCATTTAGG + Intronic
975755863 4:77570771-77570793 CCTGCCGGCCCTGGGCAGTGAGG + Intronic
975994938 4:80302947-80302969 CCTGCAGGCCCTGGGCAGTGAGG + Intronic
976520637 4:86021860-86021882 CCTGCTGGCCCCGGGCAGTGAGG - Intronic
976736296 4:88313400-88313422 CCCGCTGGCCCTGGGCAGTGAGG - Intergenic
977335236 4:95689607-95689629 TCTGCTTCTCCTGTGCAGTGGGG - Intergenic
977416655 4:96742626-96742648 ATTGCTGGCCCTGGGCAGTGAGG + Intergenic
978281580 4:107022509-107022531 TCTGCTACTCATGAGCTGTGTGG + Intronic
979857512 4:125651982-125652004 TCCGCTGGCCCTGGGCAGTGAGG - Intergenic
979865207 4:125745099-125745121 TCTGCCAGCCCTGGGCAGTGAGG + Intergenic
980115211 4:128672770-128672792 CCCGCTGCCCCCGGGCAGTGAGG + Intergenic
981487380 4:145301543-145301565 CCAGCAGCTTCTGGGCAGTGTGG + Intergenic
985604540 5:851311-851333 GCGGCTGCTCCTGGCCAGTCAGG + Intronic
985610339 5:884481-884503 TCTGGTGCTGCTGGGCTGGGTGG + Intronic
985753866 5:1701358-1701380 TGTGCTCCTCCTGGGCTCTGGGG + Intergenic
986171453 5:5318027-5318049 CCTGCTGCTGCAGGCCAGTGAGG - Intronic
986302744 5:6491051-6491073 TGTTCTGCATCTGGGCAGTGAGG + Intronic
986625892 5:9723604-9723626 CCTGCCTCTCCTTGGCAGTGAGG - Intergenic
986626158 5:9725425-9725447 CCTGCTGGCCCTGGGCAATGAGG + Intergenic
986725507 5:10593666-10593688 TCTTCTCCTCCCGGGCAGGGGGG + Intronic
988419709 5:30990376-30990398 TATGCTGCTGCTGGGCATGGTGG - Intergenic
988915903 5:35893120-35893142 CCTGCTGGCCCCGGGCAGTGGGG - Intergenic
989768573 5:45115693-45115715 CCTGCTGCTCTTGCTCAGTGAGG + Intergenic
990173347 5:53080058-53080080 TCTGCTGCTGATTAGCAGTGTGG - Intronic
990323185 5:54649273-54649295 CCTGCTGGTCCCGGGCACTGAGG - Intergenic
992048854 5:72925599-72925621 ACTGCTGGCCCTGGGCAGTGAGG + Intergenic
993697456 5:91078650-91078672 TCTGCTGCACATGGCCAGCGTGG - Intronic
993915590 5:93740695-93740717 ACTGGTGCTCCTGGGCAAGGAGG + Exonic
994122670 5:96134480-96134502 TCAGCTGCTCCTGGGCCTTTAGG + Intergenic
995727033 5:115192049-115192071 TTTGCTGCTCAAGGACAGTGTGG - Intergenic
996478705 5:123949440-123949462 ACTGCTGGTCCCGGGCAGTGAGG - Intergenic
996588388 5:125117709-125117731 TCTGGTGCTGCTGGGAAATGTGG - Intergenic
997030935 5:130126940-130126962 TCTGGTGCTCATGGCCTGTGTGG + Intronic
997210432 5:132073838-132073860 CCTGCTGCTCTTGGGCACTGTGG + Exonic
998392365 5:141795516-141795538 TCTGCTCCTCCTGGGCAGCCAGG + Intergenic
998591859 5:143487063-143487085 TCTGCTGCTTCTGGACCATGGGG + Intergenic
999229654 5:150054195-150054217 TCTGCTGCTGCTCGGCAGATTGG + Exonic
999745615 5:154589723-154589745 TCTGCTGCTCCTCATCAGCGAGG + Intergenic
1000037283 5:157459071-157459093 TAAACTGCTCCTGGGCAGTGAGG - Intronic
1000066027 5:157693946-157693968 CCTGCTGGCCCTGGGCAATGAGG + Intergenic
1001200939 5:169716022-169716044 TCTGCTGTTGATGGGCAGTTGGG + Intronic
1001321012 5:170681374-170681396 TGTGGTGCGCCTGGGGAGTGCGG + Intronic
1001519365 5:172379811-172379833 TCTGCCACTCCTGGGCTTTGTGG - Intronic
1001843552 5:174901626-174901648 GCCGCTGGCCCTGGGCAGTGAGG + Intergenic
1002081163 5:176738301-176738323 TCTGCTATTCGTGGGCTGTGTGG - Intergenic
1002429620 5:179195422-179195444 TCTGCTTCACCTGTGCAGTGTGG + Intronic
1002537841 5:179887923-179887945 TGTGATGTTGCTGGGCAGTGTGG + Intronic
1002617657 5:180465711-180465733 ACTGGTGCTCCTGGCCACTGAGG + Intergenic
1002965675 6:1963952-1963974 TCTGCTGCTCCTAGGCAGTGTGG - Intronic
1003224475 6:4191550-4191572 CCGGCTGGCCCTGGGCAGTGAGG - Intergenic
1003559679 6:7170389-7170411 TCTGCTGCTCCTGGGCAGTGAGG - Intronic
1003983981 6:11417245-11417267 GCTGCAGGTGCTGGGCAGTGAGG - Intergenic
1004476803 6:15980853-15980875 TCTGCTGTTCATGGCCATTGGGG + Intergenic
1004497783 6:16180977-16180999 TCTGCCGTCCCTAGGCAGTGAGG - Intergenic
1004843691 6:19614955-19614977 TGTGCTGCTCCTGGGGGGTGGGG - Intergenic
1004852024 6:19709379-19709401 TTTGCTTCTCCTGGGAACTGTGG - Intergenic
1006022721 6:31126806-31126828 CCTGCTGCTTTTGGGAAGTGGGG - Intronic
1006297259 6:33175404-33175426 TCAGCTGCTGATGGGCAGAGGGG - Intronic
1006387471 6:33739363-33739385 CCTCCTGCTCCTGAGCTGTGTGG + Intronic
1006630522 6:35427105-35427127 GCGGCTGCTACTGGGCAGGGGGG - Exonic
1006759097 6:36443330-36443352 TCTGGTGATCCTGGGGAGGGAGG + Intronic
1006896770 6:37476239-37476261 CCTGCTGCTCCCGTCCAGTGAGG + Intronic
1007735078 6:43977196-43977218 TCTGCTCCTCATGGGCATTTGGG + Intergenic
1007955441 6:45914061-45914083 TCTGCTGCTTGTTGGCTGTGTGG - Intronic
1008230892 6:48984052-48984074 CCTGCCGGCCCTGGGCAGTGAGG + Intergenic
1008308352 6:49933786-49933808 CCTGCTGGCCCCGGGCAGTGAGG + Intergenic
1009407110 6:63326706-63326728 GCTGCTGGCCCTGGGCAATGAGG - Intergenic
1009510802 6:64547933-64547955 CCTGCTGGCACTGGGCAGTGAGG - Intronic
1010269334 6:73903267-73903289 GCCACTGGTCCTGGGCAGTGAGG + Intergenic
1011143686 6:84189476-84189498 CCTGCTGGCCCTGGGCAATGGGG + Intronic
1013410786 6:109881395-109881417 CCTGCTGGCCCTGGGCAATGAGG - Intergenic
1013623968 6:111919014-111919036 TCTGCCGCTTCTGGGCTGTCCGG + Intergenic
1013954003 6:115819379-115819401 GCTGCTGCAACTGGGGAGTGAGG - Intergenic
1016986838 6:149901473-149901495 TCTGCTGCTAGAGGGCACTGGGG + Intergenic
1017394136 6:153977035-153977057 TATGTTGCTGCTGGGCAGAGTGG - Intergenic
1017862557 6:158412741-158412763 TCTGCTAGTCCTGTGCTGTGGGG - Intronic
1018029715 6:159832240-159832262 TCTGCTGCTCCTGGATGCTGTGG + Intergenic
1018203523 6:161416043-161416065 TCTGCTGCGCCTGGGGTGGGAGG - Intronic
1018791523 6:167151984-167152006 TCTGCTGCTCTTTAGCTGTGTGG - Intronic
1018902020 6:168056416-168056438 GCTTCAGCTCCGGGGCAGTGGGG + Exonic
1019109470 6:169698327-169698349 TCTCCTGCTCCATGGCAGGGTGG + Intronic
1019219222 6:170461728-170461750 CGTGCTCATCCTGGGCAGTGAGG - Intergenic
1019293061 7:259755-259777 TCTGCAGCTCCTGGCCAAGGAGG + Exonic
1019411159 7:907372-907394 CCTGGTGCTCCTGGGCTCTGGGG - Intronic
1019604521 7:1901815-1901837 GCAGGTGCTCCTGGTCAGTGTGG - Intronic
1019735920 7:2649668-2649690 GCTGCTGGACCTGGGCACTGGGG + Intronic
1020130009 7:5554566-5554588 TCTCCTGCTGCTGGGCCGTAAGG - Intronic
1020138374 7:5598990-5599012 CCTGCGGCTTCTGTGCAGTGGGG + Intronic
1022491799 7:30826309-30826331 TGTGTTTCTTCTGGGCAGTGAGG + Intronic
1022750428 7:33219082-33219104 CCTGCTGGCCCTGGGCAATGAGG + Intronic
1023738794 7:43259099-43259121 GCTGCTGCTCCTGGCCAAAGTGG - Intronic
1023861733 7:44220887-44220909 TCTCCTGCTTCCGGGCTGTGGGG + Exonic
1024003080 7:45203789-45203811 GCTGCTGCCCCTGGACAGTGGGG - Intergenic
1024139352 7:46446088-46446110 CCTGCTGCTCCTGGACAGTCTGG + Intergenic
1024414187 7:49083079-49083101 GCTCTTGCTACTGGGCAGTGTGG - Intergenic
1024748216 7:52431493-52431515 TCCGCAGGCCCTGGGCAGTGAGG - Intergenic
1025093929 7:56083521-56083543 TGTGCTGCTCCCTTGCAGTGTGG - Intronic
1025109091 7:56197736-56197758 CCTCCTGCACCTGGGCAGAGTGG - Intergenic
1026308636 7:69165249-69165271 CCTCCTGCACCTGGGCAGAGTGG + Intergenic
1026479296 7:70764520-70764542 ACTGCTGCTTCAGGGCTGTGGGG - Intronic
1026780477 7:73263307-73263329 GGTGCTTCTCCTGTGCAGTGTGG - Intergenic
1026870535 7:73848525-73848547 TGTGCTGCTCCTGGGGTGTGAGG + Intergenic
1027021336 7:74816748-74816770 GGTGCTTCTCCTGTGCAGTGTGG - Intronic
1027066689 7:75129189-75129211 GGTGCTTCTCCTGTGCAGTGTGG + Intronic
1027579723 7:79977855-79977877 CCTGCCGGCCCTGGGCAGTGAGG - Intergenic
1027665884 7:81042816-81042838 CCTGCTGGCCCTGGGCAATGAGG + Intergenic
1027674461 7:81141846-81141868 TCTGCCGGCCCTGGGCAATGAGG + Intergenic
1027698295 7:81437341-81437363 CCTGCTGGCCCTGGGCAGTGAGG - Intergenic
1028727167 7:94101000-94101022 GCCGCTGGCCCTGGGCAGTGAGG + Intergenic
1029706876 7:102280791-102280813 TCTGCCGCTCCTGCACAGGGAGG - Intronic
1029736852 7:102469837-102469859 GCTGCTGCTGCTGGGACGTGCGG + Exonic
1031902856 7:127429278-127429300 ACTGCTGGCCCTGGGCAGTGAGG + Intronic
1032388009 7:131537962-131537984 TCTGCTGCTGATGGGCATTTGGG + Intronic
1032997656 7:137465880-137465902 TGTGCTTCTCCTGGCCTGTGAGG - Intronic
1033284294 7:140027107-140027129 TCCGCTCCCCCAGGGCAGTGTGG - Intronic
1033725914 7:144118583-144118605 TCTGCTGCTCCTCGGGATGGCGG + Intergenic
1034421962 7:150995293-150995315 CCTGCTGCGCCTGGGCGCTGAGG - Exonic
1034949596 7:155288047-155288069 ACTGCTGACCCTGGGCAGGGAGG - Intergenic
1034973274 7:155432449-155432471 TCTGAGGCTCCTGGGCTCTGAGG + Intergenic
1035133408 7:156676210-156676232 TCTGTTACTCCTGGGAACTGTGG - Intronic
1035361534 7:158316737-158316759 GCTTCTCCTCCTGGGCGGTGAGG - Intronic
1036390353 8:8319116-8319138 AGTCCTGCTCCTGGGCAGGGGGG + Exonic
1037263852 8:17037070-17037092 CCTGCTGGCCCCGGGCAGTGAGG - Intronic
1037983517 8:23272224-23272246 CCTGCTGGCCCTGGGCAATGAGG + Intronic
1038318945 8:26511404-26511426 TCTGGGGCTCCTGGGCACAGGGG - Intronic
1039284856 8:36028934-36028956 CCTGCTGGCCCTGGGCAATGAGG + Intergenic
1040003878 8:42601561-42601583 GCTGCAGCTCCTGTCCAGTGAGG - Intergenic
1040705754 8:50124729-50124751 TCTGCTTGTGCTAGGCAGTGAGG + Intronic
1041251494 8:55939248-55939270 TCAGCTGTGCCTGAGCAGTGAGG + Intronic
1042734159 8:71969075-71969097 TATTTTGCTCCTGGGCAGAGAGG - Intronic
1042744695 8:72095269-72095291 TATTCTGTTTCTGGGCAGTGGGG + Intronic
1042837295 8:73090456-73090478 ACTGTGGCTCCTGGGCAGGGCGG - Intronic
1043435313 8:80231916-80231938 TCTGCCGGCCCCGGGCAGTGAGG + Intergenic
1043709872 8:83403050-83403072 CCTGCTGGCCCCGGGCAGTGGGG + Intergenic
1043876942 8:85495989-85496011 TCCACTGCTCCTGGGCAAGGTGG + Intergenic
1045232335 8:100317027-100317049 GCTGCTGGTCCCGGGCAATGAGG - Intronic
1046216731 8:111157891-111157913 TCTGCTGCTGATGGGCATTTAGG - Intergenic
1046442786 8:114281372-114281394 TCTTCTGCCACTGGGGAGTGGGG - Intergenic
1046669785 8:117044806-117044828 TCAGATCCTCCTGGGCGGTGGGG + Intronic
1046695277 8:117332882-117332904 CCTGCTGCACCTCCGCAGTGAGG - Intergenic
1047812322 8:128424377-128424399 TCAGCTGCTCTTTGACAGTGGGG - Intergenic
1047998204 8:130357103-130357125 TCTGCTGCTCCTTGGCTTTCAGG + Intronic
1048614690 8:136059984-136060006 TGGTCTGCTCCTGGGCATTGGGG - Intergenic
1048846164 8:138605404-138605426 TCTGCTGCTACTGAGCAGCCAGG - Intronic
1049157491 8:141075745-141075767 CCTGCTGCTTCTGTGCAATGGGG - Intergenic
1049157699 8:141076795-141076817 CCTGCCGGCCCTGGGCAGTGAGG + Intergenic
1049253310 8:141600867-141600889 TCTACTTCTTCTGGGCTGTGTGG + Intergenic
1049388549 8:142356418-142356440 TCTGCTGCCCCAGGGGAGAGTGG + Intronic
1049500302 8:142959584-142959606 CCTGCCGGCCCTGGGCAGTGAGG + Intergenic
1049529905 8:143148999-143149021 CCTGCTCCTCCTGGGCTCTGCGG - Intergenic
1049657648 8:143805801-143805823 ACTGCTGCTCCTGGGTGTTGGGG - Intronic
1049665021 8:143839191-143839213 TCTCCCGCCCCTTGGCAGTGTGG - Exonic
1049705876 8:144041735-144041757 TGTGCGGCTGCTGGGCAGGGAGG + Intronic
1049787758 8:144459202-144459224 TCTGCGGCCCGAGGGCAGTGTGG - Intronic
1050296175 9:4207724-4207746 TCTGCTACTCATGAGCTGTGTGG - Intronic
1050429666 9:5549833-5549855 GCTACAGCTCCTGGGAAGTGGGG - Intronic
1050802359 9:9631124-9631146 TCTGCTACTCCTTAGCTGTGTGG + Intronic
1051171855 9:14326376-14326398 TGTGCCTGTCCTGGGCAGTGTGG - Intronic
1051425104 9:16924675-16924697 GCTGCTGGCTCTGGGCAGTGAGG - Intergenic
1052067336 9:24038297-24038319 TCAGCTGCTCCTTGGCAGTGCGG + Intergenic
1053411460 9:37918653-37918675 TCTGCTGCTGGTGAGCTGTGTGG + Intronic
1054810600 9:69430983-69431005 TCTGCACCTCCTGGGAAGGGAGG + Exonic
1055803020 9:80061135-80061157 GCTGGTGCTCTTGGGCAGTGGGG + Intergenic
1056080973 9:83093550-83093572 CCTGCTGGCCCTGGGCAATGAGG - Intergenic
1056753147 9:89365946-89365968 TCTGGTGATCCTGGACAGTGGGG - Intronic
1057386014 9:94606670-94606692 TGTGGGGCTCCTGAGCAGTGTGG - Intronic
1057390776 9:94639921-94639943 TCTGCAGCTCCTGCCCCGTGTGG + Intronic
1057444945 9:95107194-95107216 TCTGCAGGTCCTGGGCTGAGAGG + Exonic
1057502702 9:95608304-95608326 GCTGCTGCTCCTGTCCATTGTGG + Intergenic
1057704446 9:97387377-97387399 TCTCCTGCAGCTGGGCAGCGAGG + Intergenic
1058021894 9:100098774-100098796 CCTTCTGCTCCTGGTGAGTGAGG - Exonic
1058554531 9:106152866-106152888 TCAGAAGCTCCTGGGCATTGAGG - Intergenic
1060341855 9:122784479-122784501 ATTGCTCCTCCTGGGTAGTGAGG + Intergenic
1061357808 9:130119557-130119579 TCTGCTGCTCACTGGCTGTGTGG - Intronic
1061709812 9:132479977-132479999 TCTGCTTCTCCTGCTCAGGGAGG - Intronic
1062045934 9:134424524-134424546 TCAGCTGCTCGTGGGTAGTGGGG - Intronic
1062213006 9:135374563-135374585 TCTGCTGTCCCTGGACAGTGGGG - Intergenic
1203776687 EBV:77222-77244 TCTGCTGCTGCTGGTCATGGCGG - Intergenic
1187395050 X:18911973-18911995 TCTGCCACTGCTGGGCAGTAGGG + Intronic
1187968541 X:24636948-24636970 TCTGCTTCTGCTGGGCATTTGGG + Intronic
1188362809 X:29277233-29277255 TTTTCTGCTCCTGTTCAGTGTGG + Intronic
1189604691 X:42664163-42664185 TCTGCTACTTCTAGGCTGTGAGG + Intergenic
1189804020 X:44717673-44717695 TCTCCTGCTCTTGGACACTGGGG - Intergenic
1190187195 X:48245532-48245554 TCTTTTCCTCCTGGGCAGAGTGG - Intronic
1190258895 X:48785978-48786000 TCTGCTGCCCCAGGGCAGGCCGG + Intergenic
1191104215 X:56762410-56762432 TCTTCTGCTCCTTGGTAATGGGG + Intergenic
1191984332 X:66962182-66962204 TCTGCTGCTCCTGGGCAGTGGGG + Intergenic
1193270949 X:79530190-79530212 TGTGCTGCACCTTGGCAGGGGGG + Intergenic
1193455222 X:81724010-81724032 TCAGCTGCTGCTGGGAAGTTGGG - Intergenic
1193868208 X:86763209-86763231 TCTACTGCTCATGGGCATTTGGG - Intronic
1194201484 X:90957981-90958003 TCTGGAGGTCCTGGTCAGTGAGG - Intergenic
1194360855 X:92949088-92949110 TCTGATGCTGCTGGGCATGGTGG + Intergenic
1194384371 X:93235838-93235860 CCCGCTGGCCCTGGGCAGTGAGG + Intergenic
1194626745 X:96234268-96234290 CCAGCTGCTCCAGGACAGTGGGG - Intergenic
1195225174 X:102785083-102785105 GTTGCTGCTGCTGGGCAATGGGG + Intergenic
1196398382 X:115289685-115289707 TCTGCTCCTCCTGCGCGGTGAGG + Intergenic
1196532650 X:116806849-116806871 TCAGCTGCTTCTGGACGGTGTGG + Intergenic
1197241730 X:124128627-124128649 GCTGCCGCTACTGGGAAGTGAGG - Intronic
1197263078 X:124337101-124337123 TCTTCTGCTCCAGGGTGGTGGGG + Intronic
1197344840 X:125319316-125319338 CCTGCTGGCCCTGGGCAATGAGG - Intergenic
1198271321 X:135058900-135058922 TCTTATGCTGATGGGCAGTGAGG - Intergenic
1200046923 X:153408170-153408192 TCTGCTGATCCTCTTCAGTGTGG - Intergenic
1200423575 Y:2998629-2998651 CCTGCTGGCCCCGGGCAGTGGGG - Intergenic
1200512602 Y:4099223-4099245 CCTGCTGGCCCCGGGCAGTGGGG + Intergenic
1200547325 Y:4533436-4533458 TCTGGAGGTCCTGGCCAGTGAGG - Intergenic
1200669056 Y:6064903-6064925 TCTGATGCTGCTGGGCACGGTGG + Intergenic
1201573020 Y:15433951-15433973 CCTGCTGGCCCCGGGCAGTGAGG + Intergenic