ID: 1191984985

View in Genome Browser
Species Human (GRCh38)
Location X:66970002-66970024
Sequence CGGTGAGAATGGAACAAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191984980_1191984985 12 Left 1191984980 X:66969967-66969989 CCAAACCTACATTTGACTGATGT No data
Right 1191984985 X:66970002-66970024 CGGTGAGAATGGAACAAAGTTGG No data
1191984981_1191984985 7 Left 1191984981 X:66969972-66969994 CCTACATTTGACTGATGTACCTG No data
Right 1191984985 X:66970002-66970024 CGGTGAGAATGGAACAAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191984985 Original CRISPR CGGTGAGAATGGAACAAAGT TGG Intergenic
No off target data available for this crispr