ID: 1191986652

View in Genome Browser
Species Human (GRCh38)
Location X:66988233-66988255
Sequence CCCTGCACAAAACACCTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191986642_1191986652 19 Left 1191986642 X:66988191-66988213 CCTTTGCACTGCCCTAGCAGATG No data
Right 1191986652 X:66988233-66988255 CCCTGCACAAAACACCTGTCTGG No data
1191986641_1191986652 20 Left 1191986641 X:66988190-66988212 CCCTTTGCACTGCCCTAGCAGAT No data
Right 1191986652 X:66988233-66988255 CCCTGCACAAAACACCTGTCTGG No data
1191986647_1191986652 -8 Left 1191986647 X:66988218-66988240 CCATGAGGGTCCCACCCCTGCAC No data
Right 1191986652 X:66988233-66988255 CCCTGCACAAAACACCTGTCTGG No data
1191986643_1191986652 8 Left 1191986643 X:66988202-66988224 CCCTAGCAGATGTTCTCCATGAG 0: 39
1: 1478
2: 1963
3: 1505
4: 986
Right 1191986652 X:66988233-66988255 CCCTGCACAAAACACCTGTCTGG No data
1191986644_1191986652 7 Left 1191986644 X:66988203-66988225 CCTAGCAGATGTTCTCCATGAGG 0: 34
1: 1220
2: 1889
3: 1638
4: 1172
Right 1191986652 X:66988233-66988255 CCCTGCACAAAACACCTGTCTGG No data
1191986640_1191986652 21 Left 1191986640 X:66988189-66988211 CCCCTTTGCACTGCCCTAGCAGA 0: 14
1: 70
2: 955
3: 1355
4: 1727
Right 1191986652 X:66988233-66988255 CCCTGCACAAAACACCTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191986652 Original CRISPR CCCTGCACAAAACACCTGTC TGG Intergenic
No off target data available for this crispr