ID: 1191987711

View in Genome Browser
Species Human (GRCh38)
Location X:67000549-67000571
Sequence ACTAGGCAGTGCCCCAGTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191987705_1191987711 -5 Left 1191987705 X:67000531-67000553 CCCTCTCCTCACATCTCCACTAG No data
Right 1191987711 X:67000549-67000571 ACTAGGCAGTGCCCCAGTGGAGG No data
1191987704_1191987711 16 Left 1191987704 X:67000510-67000532 CCAGGGTCTGGAGGACAGTGGCC No data
Right 1191987711 X:67000549-67000571 ACTAGGCAGTGCCCCAGTGGAGG No data
1191987706_1191987711 -6 Left 1191987706 X:67000532-67000554 CCTCTCCTCACATCTCCACTAGG No data
Right 1191987711 X:67000549-67000571 ACTAGGCAGTGCCCCAGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191987711 Original CRISPR ACTAGGCAGTGCCCCAGTGG AGG Intergenic