ID: 1191990918

View in Genome Browser
Species Human (GRCh38)
Location X:67036038-67036060
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 3980
Summary {0: 5, 1: 398, 2: 973, 3: 1219, 4: 1385}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191990918 Original CRISPR AATAACTAAGAGAGTATAAT TGG (reversed) Intergenic
Too many off-targets to display for this crispr