ID: 1192016442

View in Genome Browser
Species Human (GRCh38)
Location X:67336548-67336570
Sequence ACTTATAAAAAGAAGGAGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192016432_1192016442 21 Left 1192016432 X:67336504-67336526 CCAAGCTGCCAATGTCTTCCACT No data
Right 1192016442 X:67336548-67336570 ACTTATAAAAAGAAGGAGTTGGG No data
1192016435_1192016442 13 Left 1192016435 X:67336512-67336534 CCAATGTCTTCCACTCTCTGGGT No data
Right 1192016442 X:67336548-67336570 ACTTATAAAAAGAAGGAGTTGGG No data
1192016436_1192016442 3 Left 1192016436 X:67336522-67336544 CCACTCTCTGGGTTCCAGTGTAC No data
Right 1192016442 X:67336548-67336570 ACTTATAAAAAGAAGGAGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192016442 Original CRISPR ACTTATAAAAAGAAGGAGTT GGG Intergenic
No off target data available for this crispr