ID: 1192032199

View in Genome Browser
Species Human (GRCh38)
Location X:67525578-67525600
Sequence CCTGCTCTTCAGAAGCTCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192032190_1192032199 25 Left 1192032190 X:67525530-67525552 CCAAGCCAGTACTAAGAACTGGG No data
Right 1192032199 X:67525578-67525600 CCTGCTCTTCAGAAGCTCAAAGG No data
1192032195_1192032199 20 Left 1192032195 X:67525535-67525557 CCAGTACTAAGAACTGGGGGGAC No data
Right 1192032199 X:67525578-67525600 CCTGCTCTTCAGAAGCTCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192032199 Original CRISPR CCTGCTCTTCAGAAGCTCAA AGG Intergenic
No off target data available for this crispr