ID: 1192034134

View in Genome Browser
Species Human (GRCh38)
Location X:67545408-67545430
Sequence CAGCAGCAGCAGGGTGAGGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1077
Summary {0: 1, 1: 0, 2: 12, 3: 131, 4: 933}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192034128_1192034134 -10 Left 1192034128 X:67545395-67545417 CCCCAGGCAGCAGCAGCAGCAGC 0: 4
1: 11
2: 114
3: 470
4: 1543
Right 1192034134 X:67545408-67545430 CAGCAGCAGCAGGGTGAGGATGG 0: 1
1: 0
2: 12
3: 131
4: 933

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192034134 Original CRISPR CAGCAGCAGCAGGGTGAGGA TGG Exonic
900289064 1:1916160-1916182 CAGCAGCTGCAGGGCCAGGCGGG - Intronic
900384993 1:2406474-2406496 GTGCAGCAGCAAGGTGAGGTGGG - Exonic
900508532 1:3043939-3043961 AAGCAGCAGCAGGGTGGGAAAGG - Intergenic
900708392 1:4094803-4094825 CACCAGCAGCTGGATGAGGCTGG + Intergenic
900736541 1:4302865-4302887 GAGCAGCAGCAGGGAGAGGCAGG - Intergenic
900822036 1:4897209-4897231 CAGAAGCAGGAGGGAGAGGCGGG + Intergenic
900944620 1:5822838-5822860 GGGCAGAAGCATGGTGAGGACGG - Intergenic
901034361 1:6327385-6327407 CGGCAGGAGCAGGAGGAGGAGGG - Exonic
901224754 1:7606803-7606825 AAGGATCATCAGGGTGAGGAGGG + Intronic
901354643 1:8634155-8634177 TAGTAGCAGCAGCGTGAGGATGG - Intronic
901397565 1:8992563-8992585 AAGCAGCAGGAAGGTGGGGATGG - Intergenic
901647751 1:10725788-10725810 CAGCGGCAGTGGGGTGGGGAGGG + Intronic
901681536 1:10915742-10915764 CAGAAGCAGGAGGGAGAGAAGGG + Intergenic
901751728 1:11414211-11414233 CAGACAAAGCAGGGTGAGGAGGG - Intergenic
901771950 1:11535080-11535102 CAGCAGGAGCAGGATGTGGGTGG - Exonic
901814310 1:11785198-11785220 CGGCCGGAGCTGGGTGAGGATGG - Exonic
902091766 1:13909373-13909395 CAGGGGCAAGAGGGTGAGGAGGG + Intergenic
902165301 1:14565644-14565666 AAGCAGCAGCAGGGTTTGAAGGG - Intergenic
902450823 1:16495972-16495994 CAGCAGCAGGAGGATAATGAAGG - Intergenic
902502044 1:16917367-16917389 CAGCAGCAGGAGGATAACGAAGG + Intronic
902515257 1:16986505-16986527 CAGCAGCAGCAGCTTGAAGCCGG + Exonic
902546025 1:17190824-17190846 GTGTAGCAGCAGCGTGAGGAAGG - Intergenic
903076510 1:20772373-20772395 GAGCAGCATCATAGTGAGGATGG - Intronic
903117830 1:21192678-21192700 TGGCAGCAGGAGAGTGAGGAAGG - Intergenic
903332002 1:22601223-22601245 CAGAAGAAGCAGGCTGAGGAAGG - Intronic
903333229 1:22608211-22608233 CAGGGGCAGAAGGGAGAGGAAGG - Intergenic
903383497 1:22912440-22912462 CAGCAGCGGCAGGTTGATGCTGG - Exonic
903413811 1:23168224-23168246 CAGCAGCAGGAGGAGGAGGGCGG - Intronic
903413812 1:23168227-23168249 CTGCAGCAGCAGGAGGAGGAGGG - Intronic
903549919 1:24150688-24150710 CAGCAGTAGGAGGAGGAGGAGGG + Intergenic
903603527 1:24558632-24558654 CAGGAGCAACAGGATGAGGGGGG - Intronic
903907403 1:26696488-26696510 CAGCAGCAGCGGGAGGAGGCGGG + Exonic
903931375 1:26864241-26864263 CAGAGGCAGCAGGGGCAGGAGGG - Exonic
903950099 1:26991634-26991656 CAGAAGCGGCTGGGAGAGGAAGG - Intergenic
904014610 1:27409944-27409966 CAGCAAAATCAGGGTGAGGTGGG + Exonic
904028860 1:27521544-27521566 CAGCAGCAGCAGGGGCGAGAAGG - Intergenic
904263773 1:29306153-29306175 CAGCAGCAGCAGGACTTGGATGG + Intronic
904384077 1:30130282-30130304 CAGCAGGAGCTGGCTGAGGAGGG + Intergenic
904421608 1:30398054-30398076 AGGCTGCAGCAGGATGAGGAGGG + Intergenic
904696164 1:32332737-32332759 CAGAAGCCAAAGGGTGAGGAAGG + Exonic
904797857 1:33070958-33070980 CAGCAGCAGCAGCTGGAGAAAGG + Intronic
904881090 1:33697618-33697640 CACCAACAGGAGGGAGAGGAAGG - Intronic
905248920 1:36635694-36635716 TACCAGCAGCAGGTTGAGGTCGG - Intergenic
905385405 1:37600016-37600038 TAGCAGAGCCAGGGTGAGGAAGG + Intergenic
905842058 1:41189562-41189584 CACCAGAAGAAGGGGGAGGAAGG + Intronic
905887645 1:41500278-41500300 CAGCAGAAAGAGGGTGAGGTCGG - Intergenic
905972652 1:42153491-42153513 CAGCAGCAGCAGGAGGACCACGG - Exonic
906114801 1:43349311-43349333 CAGCAGCAGCAGGCCCAGGACGG - Exonic
906124443 1:43418838-43418860 GAGCAGCAGCAGGAGGAGGGTGG + Intronic
906280416 1:44549631-44549653 CAGCAGGAGGAAGGGGAGGAAGG - Intronic
906558680 1:46736889-46736911 AAGCAGCAGCAGGGTTTGGGAGG - Intergenic
906581835 1:46941344-46941366 CAGCAGAAGCAGAATGAGCAGGG + Exonic
906601882 1:47137553-47137575 CAGCAGAAGCAGAATGAGCAGGG - Exonic
906680764 1:47724184-47724206 CAGCAGCAGCAGGGTGCAGTAGG + Intergenic
907045639 1:51298529-51298551 CTGCACCACCAGGGTTAGGATGG + Intronic
907053635 1:51345542-51345564 CACCAGCAGCAGGGGGCTGATGG + Intergenic
907243639 1:53093901-53093923 CAGGAGCAGGAGGGAGAGGCAGG - Intronic
907404516 1:54245672-54245694 GAGCAGCCACAGGGTGAGGCGGG - Intronic
907534740 1:55140720-55140742 GGGCAGCAGCAGAGTGAGGTAGG + Intronic
907865752 1:58397659-58397681 CAGAAGGAGCAGGCTGGGGAAGG - Intronic
908213762 1:61929987-61930009 CGGCAGCAGTGGGGTCAGGAAGG + Intronic
908723309 1:67148809-67148831 CAGTAGCAGCAGTGTTAGAACGG + Intronic
908809016 1:67960091-67960113 GAGGAGCAGCAGGATCAGGAGGG - Intergenic
909340745 1:74528282-74528304 GAGCCTGAGCAGGGTGAGGAGGG + Intronic
909584820 1:77278409-77278431 TAGCAGGAACAGGGTGAGGAAGG - Intergenic
910619361 1:89236100-89236122 CAGCACCAGCAGGGTAAAAAAGG + Intergenic
910867737 1:91803451-91803473 CAGAAGCAGCATGCTGAGGAGGG + Intronic
910983732 1:92983909-92983931 AAGCAGCAGCAGGGTTTGGGAGG + Intergenic
911090961 1:94016484-94016506 CAGCTGGAGCAGGGAGAGGACGG + Intronic
912415835 1:109507906-109507928 CAGCAGGTGCAGGTCGAGGACGG - Exonic
912502326 1:110130511-110130533 CAGGAGCAGCAGGGGGAGCCAGG + Intergenic
912696721 1:111847744-111847766 CAGCAGCTGGAGAGGGAGGATGG + Intronic
914242517 1:145861285-145861307 CAGTAGTTGCAGGATGAGGAAGG + Intergenic
914424965 1:147567159-147567181 CAGCAGAAGGAGGGTTGGGAAGG - Intronic
915118705 1:153615560-153615582 CAGCAGCTACAGGTTGGGGAAGG + Intronic
915191872 1:154157610-154157632 GAGCAGCAGCAGGGTGGGACTGG + Intronic
915471580 1:156128952-156128974 AAGCAGCTGCAGGGGGAGGAGGG - Intronic
915605581 1:156948113-156948135 GAGGAGCAGCTGGGTGTGGATGG + Intronic
915689739 1:157676859-157676881 AATCAGCAGCAGGGTTAGAAAGG + Exonic
915747602 1:158176656-158176678 CAGCAGCTGCAGGGGGCAGAGGG + Intergenic
915824297 1:159058473-159058495 CAGCCCCAGCAGGGAGGGGAGGG + Intergenic
916557832 1:165908583-165908605 GAGAAGCAGGAGGGTGAGGAAGG - Intronic
916778683 1:167998551-167998573 AAGCAGCAGCAGGGTTTGAAAGG - Intronic
917120465 1:171640886-171640908 CAGCAGTTGTTGGGTGAGGAAGG + Intronic
917284143 1:173407015-173407037 CAGCAGCAGCAGGATGAGAAGGG + Intergenic
917688701 1:177445173-177445195 CAGCAGCACCTGGGTGTGGCTGG + Intergenic
917964417 1:180169356-180169378 CAGCAGCATAGGGGTGGGGAAGG + Intronic
918534561 1:185559879-185559901 CAGCAGCTGCAGGGTTACTAAGG + Intergenic
919054000 1:192546127-192546149 GAGCAGATGCAGGCTGAGGAAGG + Intergenic
919757850 1:201077052-201077074 CAGCAGCAGCAGGGAGGCGATGG + Exonic
919826419 1:201506695-201506717 CCCCAGCAGGAGGGTGAGGGAGG + Intronic
919919693 1:202160692-202160714 CAGCGGCAGCAGGCACAGGAGGG - Exonic
920300191 1:204983717-204983739 GAGACGGAGCAGGGTGAGGAAGG + Intronic
920385962 1:205570057-205570079 CAGCAGGAGTAGGATGAGGTGGG - Intronic
920528993 1:206688045-206688067 GAGAAGCAGCAGGGTGAGCTGGG - Intronic
920960020 1:210655808-210655830 CTGCAGAAGCAGGGAGAGGAGGG - Intronic
921053769 1:211528909-211528931 CAACAGCAGGAGGCTGAGGTGGG - Intergenic
921328776 1:214014872-214014894 CATCAGCAGCAGGGGCTGGACGG - Intronic
921330713 1:214033006-214033028 CATCAGCAGCAGGGGAGGGAGGG - Intronic
921394485 1:214654077-214654099 AAACAGCAGCAGGAGGAGGAGGG - Intronic
921764430 1:218953501-218953523 CAGCAGCAGCAGCAGCAGGAGGG + Intergenic
921764431 1:218953504-218953526 CAGCAGCAGCAGCAGGAGGGAGG + Intergenic
921945406 1:220882766-220882788 AAGCAGCAGGAGGAGGAGGAAGG - Intronic
922032592 1:221816532-221816554 CAGCAGCAGCAGGGTGTGAGAGG + Intergenic
922156025 1:223040211-223040233 CAGCAGCAAGAGGATGTGGATGG + Intergenic
922574700 1:226654065-226654087 CAGCCGGACCAGGGTGAGGGAGG + Intronic
922739772 1:228008431-228008453 CAGGAGCAGCGGGGAGGGGAAGG + Intronic
922785957 1:228282332-228282354 CTGCAGCAGCTGGGGGAGGCAGG - Intronic
922904750 1:229165471-229165493 CAGCAGCGGCAGGCACAGGAAGG + Intergenic
923058580 1:230449109-230449131 GAGGCACAGCAGGGTGAGGAGGG - Intergenic
923408713 1:233687479-233687501 GAGGAGCAGCCTGGTGAGGAGGG + Intergenic
923907504 1:238401778-238401800 CAGCCGGAGCAGGGGGAAGAGGG + Intergenic
924089443 1:240487277-240487299 CAGCAGGAGCCGGGAGAAGAAGG + Intergenic
924553495 1:245099450-245099472 CAGCATCAGAAGGGTGGGCAGGG - Intronic
924830475 1:247588847-247588869 GGGCAGCTGCAGGGTGAGGGTGG - Exonic
1062876884 10:949588-949610 CAGCGGCACGTGGGTGAGGACGG - Intergenic
1062968084 10:1625779-1625801 CAGCAGGAGAAGGGTGAGAGGGG - Intronic
1063099313 10:2935720-2935742 CAGCATCAGCAGGTTGGGGAAGG + Intergenic
1063159287 10:3408170-3408192 CAGCAGCAGATGGTTGATGATGG - Intergenic
1063278401 10:4597188-4597210 ATGCAGGAGCAGGGTGAGGAGGG - Intergenic
1063290730 10:4744246-4744268 CAGCAAAAGCTGGGTGAGGCAGG + Intergenic
1065140381 10:22714102-22714124 CAGCTGCAGCCGGAGGAGGAGGG + Intronic
1065196450 10:23270648-23270670 CAGCAGCAACAGGCTGGAGACGG + Intronic
1066026512 10:31363926-31363948 CAGGAGCTGCAGGGTGAGCCCGG + Intronic
1066481281 10:35798101-35798123 CAGCAGGAGCCTGATGAGGAGGG + Intergenic
1067531519 10:47077584-47077606 CAGCAGCTGAGAGGTGAGGAAGG - Intergenic
1067945098 10:50684262-50684284 CAGCCCCAGGAGGGTGGGGACGG + Intergenic
1069778339 10:70939661-70939683 CACTAGCAGCAGTGTGAGCAAGG + Intergenic
1069862137 10:71478398-71478420 CATCATCAGGAGGCTGAGGAAGG - Intronic
1069914829 10:71781008-71781030 CTGCAGCAGGAGGTTGTGGAGGG + Intronic
1069916735 10:71791186-71791208 CAGCAGCAGCAGCTCCAGGATGG - Intronic
1070350822 10:75590857-75590879 CAGCTGCAGGAGGCTGAGGCAGG - Intronic
1070625303 10:78046882-78046904 CAGCAGCAGCAGTGTCACCAGGG + Intronic
1070627515 10:78061812-78061834 CACCAGCAGCAGAGTATGGATGG - Intergenic
1070635683 10:78125376-78125398 CAGTAGAAACAGAGTGAGGAAGG + Intergenic
1070866603 10:79711134-79711156 CAGCCCCAGGAGGGTGGGGACGG + Intronic
1070880393 10:79849255-79849277 CAGCCCCAGGAGGGTGGGGACGG + Intronic
1071028738 10:81146387-81146409 CAGAAGGTGAAGGGTGAGGAAGG - Intergenic
1071633515 10:87233357-87233379 CAGCCCCAGGAGGGTGGGGACGG + Intronic
1071646962 10:87365573-87365595 CAGCCCCAGGAGGGTGGGGACGG + Intronic
1071882106 10:89910894-89910916 CAGCAGCAGCAGTGGCAGCATGG + Intergenic
1072540173 10:96392538-96392560 CACCAGCAGTAAGGTGTGGATGG + Intronic
1072872910 10:99139280-99139302 CAGAAGCAGAAGGGGGAGAAAGG + Intronic
1073094100 10:100969514-100969536 CAGCACCAGCTGCGAGAGGAAGG - Intronic
1073110635 10:101061357-101061379 CAGCGGCCGCAGGGAGAGGCGGG - Intergenic
1073330798 10:102668829-102668851 CAGCAGCTGCAGGGTGGGGCGGG + Intergenic
1073576570 10:104631046-104631068 CAGCAGCTGCAGGATGGAGAGGG - Intergenic
1074056216 10:109924485-109924507 CAGCTGAAGAAGAGTGAGGAAGG - Intergenic
1074388087 10:113033201-113033223 CAGCAGAAGGAGGAGGAGGAAGG - Intronic
1075340423 10:121643385-121643407 CAGCAAGGGCAGGGTGAGGATGG - Intergenic
1075494530 10:122908519-122908541 AAGCAGCAGCAGGCTTAGGGAGG + Intergenic
1075582639 10:123633909-123633931 CATAAGGAGCAGGGCGAGGAAGG + Intergenic
1075667323 10:124240523-124240545 CAGCAGCAGGAGATTGGGGATGG - Intergenic
1075816033 10:125265441-125265463 CAGCAGTTGTAGGGTGAGGCTGG + Intergenic
1075860850 10:125675263-125675285 CAGCACCAGCAGGGTAAAAATGG + Intronic
1075962580 10:126582081-126582103 CAGCAGCTGCAGGGTGACCTGGG - Intronic
1076352262 10:129825369-129825391 CTGCAGCAGCAGAGGGAGGGAGG + Intergenic
1076667151 10:132099870-132099892 CACCATCACCAGGGTGAGCACGG - Intergenic
1076732452 10:132445517-132445539 CAGCGGCAGGAGGCTGAGGGCGG + Intronic
1077118218 11:895005-895027 CAGCTGCAGAGGCGTGAGGACGG - Intronic
1077214122 11:1388296-1388318 CAGCAGCAGCAGCGGGGGAAAGG + Intergenic
1077342866 11:2033719-2033741 CAGCACCAGCAGGGTGGTGTGGG + Intergenic
1077496134 11:2887194-2887216 CAGCTGCAGCTGGGGGAGCAGGG + Intergenic
1077503098 11:2918021-2918043 CAGCCGCAGCAGGGAGGCGATGG - Exonic
1077554056 11:3217606-3217628 CAGGTGCAGCAGGGTGGGGAGGG + Intergenic
1077905495 11:6529762-6529784 CAGAAGCAGCAATGTCAGGAGGG - Intronic
1078355486 11:10628987-10629009 GAGCAGCAGCAGGGAGGGGTTGG - Intronic
1078707997 11:13763985-13764007 CACCATCAGCAGGGACAGGATGG - Intergenic
1078865249 11:15291255-15291277 TGGCAGCAGGAGGGTGAGCAGGG + Intergenic
1079333176 11:19549974-19549996 CAGCAGAAGCCGGGGGAGGCTGG - Intronic
1079469363 11:20763763-20763785 GAGAAGCACCAGGGTGAGGCTGG + Intronic
1080394208 11:31875063-31875085 CAGGAGCAGCAGGAGGGGGAAGG - Intronic
1081155068 11:39680160-39680182 CAACAGTTGAAGGGTGAGGAGGG + Intergenic
1081666785 11:44921239-44921261 GAGCAGCTGCAGGGCGGGGAGGG + Intronic
1081801080 11:45859766-45859788 CAGCAGCAGCAGCAGCAGGAGGG - Intronic
1081870902 11:46382086-46382108 GAGCGCCAGCAGGGCGAGGAGGG - Exonic
1082677940 11:56131591-56131613 GAGTAGAAGAAGGGTGAGGAGGG + Intergenic
1082828521 11:57598287-57598309 CAGCAGCAGGAGGGTCAGCAGGG - Exonic
1082831839 11:57624118-57624140 CAGGACCACCAGGGTGAGGATGG + Intergenic
1082902190 11:58267136-58267158 CAGCAGCACCACAGTGAGGTGGG + Exonic
1082904542 11:58292012-58292034 CAGCAGGACCACGGTGAGGTGGG + Intergenic
1082921979 11:58505409-58505431 AAGGAGGAGCAGGATGAGGAGGG + Intergenic
1083107136 11:60369122-60369144 GAGCAGTAGAAGGGAGAGGAAGG - Intronic
1083324743 11:61867494-61867516 CAGAGGCAGCAGGGAGAGGCGGG - Intergenic
1083350797 11:62027444-62027466 CAGTAGCTCCAGGGTTAGGATGG + Intergenic
1083605211 11:63974685-63974707 CAGCAGCAGCGGCGTCAGGACGG - Exonic
1084036460 11:66514389-66514411 CACCAGCTGCAGGGAGAGGATGG - Exonic
1084144714 11:67258842-67258864 GAGCAGCAGTAGGATGAGGTGGG - Intergenic
1084169876 11:67395965-67395987 CAGCAGCTGCAGGCCCAGGAAGG + Exonic
1084264453 11:67997672-67997694 CACCAGCAGCATGGCCAGGAAGG + Exonic
1084445562 11:69201734-69201756 CAGAGCCAGCAGGCTGAGGAAGG - Intergenic
1084764967 11:71302241-71302263 CAGCAGCAGCAGTAGGAGCATGG + Intergenic
1084800891 11:71543182-71543204 CAGCAGCTGCAGGTGGAGGAGGG + Intronic
1085242638 11:75071436-75071458 CACCAGCAGAAGGGGGAGGAAGG + Intergenic
1085244488 11:75089057-75089079 CACCAGGAGAAGGGGGAGGAAGG + Exonic
1085249244 11:75131324-75131346 CACCAGGAGAAGGGGGAGGAAGG + Intronic
1085282611 11:75340912-75340934 CAGCAGCAGCAGTGTGGTGCTGG - Intronic
1085527326 11:77172044-77172066 CGGCAGCAGCAGGCTGGGGGCGG - Intronic
1086274751 11:85113143-85113165 CAGCAGCAGCAGAGTACAGAAGG + Intronic
1086778437 11:90870329-90870351 AAGCAGCAGCAGGGTTTGAAAGG + Intergenic
1086845094 11:91739014-91739036 CAGAAGCAGGAGGGTGGGAAAGG + Intergenic
1087144654 11:94799812-94799834 CAACAGCAGCAGGGGGCGGTGGG + Exonic
1087235804 11:95717382-95717404 CAGAAGCAGAAAGGTGGGGATGG - Intergenic
1087594743 11:100238490-100238512 CAGCAGCAGGAGGAGGAGAAGGG + Intronic
1088528904 11:110786718-110786740 CAGGAGCAAGAGGGGGAGGAAGG - Intergenic
1088696267 11:112368656-112368678 CAGAAGCAGCAGGAGGAGGCTGG - Intergenic
1088816829 11:113427046-113427068 CATCAGCAGCAGGGAGTGGGGGG - Intronic
1088906919 11:114162113-114162135 CAGCAGCAGCATGGAGTGGCTGG + Intronic
1089462396 11:118660841-118660863 GAGCAGCAGGAGGGTGAGGGAGG - Intronic
1089538111 11:119173045-119173067 AAGGAGAAGCAGGGTGAGGGAGG + Intronic
1089609806 11:119663006-119663028 TAGCAGCACCAGGGAGGGGAGGG + Exonic
1089650766 11:119911228-119911250 CTTCAGCAGCAGAGGGAGGAGGG + Intergenic
1090210503 11:124917623-124917645 CGGCAGCTGCCGGGTGATGAGGG + Intergenic
1090911315 11:131122010-131122032 CAGAAACAGCAGGGGAAGGATGG + Intergenic
1202825852 11_KI270721v1_random:88908-88930 CAGCACCAGCAGGGTGGTGTGGG + Intergenic
1091404264 12:199134-199156 CAGCAGGGGGAGGGTGGGGAGGG + Intronic
1091533474 12:1383229-1383251 CAGAAGAAACAGGGAGAGGAGGG - Intronic
1091563522 12:1631353-1631375 CAGCAGCAGCAGGCTGGGCATGG - Exonic
1091848201 12:3673939-3673961 CAGAAGCAGCAGAGCGAGGTGGG - Intronic
1092117433 12:6019263-6019285 CATCAGGAGCAGGGTGATGCGGG + Exonic
1092502602 12:9064329-9064351 CAGCTGCAGCAGGGAGGGGCGGG + Intergenic
1092519236 12:9250314-9250336 CAGCTGAAGCAGTGTGAAGAGGG + Intergenic
1092832816 12:12461694-12461716 CAGCAGCAGCAGAGTGGAGGAGG + Intronic
1092884843 12:12915941-12915963 CAGCCGCAGCAGTGGGAGGAGGG - Exonic
1092913094 12:13165483-13165505 CAGCAGCCACAGTGTGGGGAAGG + Intergenic
1093176423 12:15918190-15918212 AAGCACCAGCGGGATGAGGAAGG - Intronic
1093554104 12:20450065-20450087 CACCAGCAGAAGGCTGATGAAGG - Intronic
1093757162 12:22865713-22865735 CAGCGTGAGCAGGGTTAGGAGGG - Intergenic
1094512713 12:31105863-31105885 CCGCAGCAGCTGGGGGAGGTTGG + Intergenic
1095714414 12:45326739-45326761 CAGCAGCTGCTGGGAGTGGATGG - Intronic
1096230344 12:49893309-49893331 CAGCAGGAGCAGAGTGTGGCAGG - Intronic
1096298217 12:50401665-50401687 AAGCAGCAGCTGCGTGATGAAGG + Intronic
1096374778 12:51099678-51099700 CAGCAGCAGAAGCATGAGGATGG - Exonic
1096452512 12:51756186-51756208 CAGCATGAGCAGGGTGACGAGGG - Intronic
1096569751 12:52515235-52515257 CAACAGCTGCAGGGAAAGGAGGG + Exonic
1096574523 12:52544428-52544450 CAGGACCAGCAGGGTGGAGATGG + Exonic
1096614062 12:52821810-52821832 CAGCAGAGGTGGGGTGAGGAGGG + Exonic
1096633483 12:52944522-52944544 CAACAGCACCAGGGTCAGAATGG + Intronic
1096919386 12:55067917-55067939 CAGCAGCAACAGTTTGAGGAAGG + Intergenic
1097585481 12:61510695-61510717 CAGCAGCAGCAGGAGAAGAATGG + Intergenic
1097811451 12:64023798-64023820 CCGCAGCAGCACTGTGAGGCAGG + Intronic
1098577976 12:72065905-72065927 AAGCAGCAGCAGGGTTTGAAAGG + Intronic
1098742029 12:74184882-74184904 GAGCAGCTCCAGGGTGAGGGTGG - Intergenic
1099293586 12:80802744-80802766 CAGGAGGAGGAGGGTGAGGCAGG - Intronic
1100449927 12:94696066-94696088 GAGCAGCAGCAGGGGGAAGGAGG + Intergenic
1100702306 12:97161470-97161492 GGGCTGAAGCAGGGTGAGGAGGG + Intergenic
1100725830 12:97407587-97407609 CAGGAGCTGCAGAGTGAGGTTGG - Intergenic
1101236765 12:102797564-102797586 GGGCATCAGGAGGGTGAGGAGGG + Intergenic
1101363505 12:104049983-104050005 CAGCCGAAGCAGCGTGAGGGCGG - Exonic
1101679287 12:106949192-106949214 CTTCTGCAGCAGGGAGAGGAGGG - Intergenic
1101865525 12:108517079-108517101 CGGCAGCAGCAGGGCCAGCAGGG - Exonic
1102039771 12:109793484-109793506 CGGCAGCTTCTGGGTGAGGAAGG - Intronic
1102346363 12:112163614-112163636 CAGCAGCTGCAGGGGGATGATGG + Exonic
1102408411 12:112694508-112694530 CAGCAGCAGCAGCATAAGAAAGG + Intronic
1102492125 12:113295829-113295851 CAGTACCAGCTGGGTGAGGCTGG + Intronic
1102504440 12:113374783-113374805 GAGCTGCAGCAGGCTGAGGAGGG - Exonic
1102519875 12:113471595-113471617 CAGCAGCTGCAGGGCGAGTCTGG + Exonic
1103331658 12:120158469-120158491 CATCACCAGCAGGGTGGGCAAGG - Exonic
1103730837 12:123026773-123026795 CAGCAGCAGCTGGAAGAGGCAGG - Intronic
1104421893 12:128642840-128642862 CAGAAGCAGCAGGCTGTGGTTGG + Intronic
1104769140 12:131349851-131349873 CAGAAGCATCAGGGTGAAGCCGG + Intergenic
1104812850 12:131628889-131628911 CAGCAGGTGCAGAGTGAGGAGGG - Intergenic
1104842436 12:131831507-131831529 GAGCAGCTGCAGGGTGAGAGGGG - Intronic
1104858692 12:131913799-131913821 GAGCTGCTGCAGGGTGGGGATGG - Exonic
1104934578 12:132357724-132357746 CAGAGGCAGCAGGGAGCGGATGG - Intergenic
1105282145 13:18971994-18972016 CAGCAGCTGCAGCTTGAGGGAGG + Intergenic
1106231744 13:27826058-27826080 CACCAGCAGCAGGGTCACGATGG + Intergenic
1106271628 13:28159774-28159796 GAGTAGGAGGAGGGTGAGGAAGG + Intronic
1106360761 13:29028511-29028533 CTGAAGCAGCAGAGTGAGAAAGG - Intronic
1106833921 13:33613797-33613819 ATTTAGCAGCAGGGTGAGGAAGG + Intergenic
1107022799 13:35768330-35768352 CTGCAGCAGCAGCCTGTGGATGG + Intergenic
1107126999 13:36856765-36856787 CAGCAGGTCCAGGGTGAGGCCGG + Intronic
1107263039 13:38518559-38518581 CAGCAGCAGCTGGGGGAACAAGG - Intergenic
1107522841 13:41200714-41200736 GAGCAGTAGCTGGGTGAGGTAGG - Intergenic
1107588509 13:41879305-41879327 CAGCAGCAGAAAGAGGAGGAGGG - Intronic
1108185494 13:47884644-47884666 CAGCGGCAGCATGGTGAAGCAGG + Intergenic
1108466029 13:50715964-50715986 CTGCCTCAGCAGGGTGTGGAGGG - Intronic
1108512902 13:51171531-51171553 CAGGAGCAGCCTGGGGAGGAAGG - Intergenic
1108642256 13:52394101-52394123 CAGCAGCAGCAGGAAGACGCTGG - Intronic
1109686551 13:65829361-65829383 CAGCTGCAGCGGGGTGGGCATGG + Intergenic
1109716837 13:66230422-66230444 CAGGAGCAGCCTGGGGAGGAAGG + Intergenic
1110390727 13:74970684-74970706 CAGCAGGAGCAGGGAAAGCAAGG + Intergenic
1111063816 13:83063463-83063485 CAGCAGCAGCTGAGACAGGAGGG - Intergenic
1111154068 13:84298977-84298999 CAGCTACAGGAGGCTGAGGAAGG - Intergenic
1111173984 13:84567952-84567974 CAGCAGCAGCAGAGTTTGAAAGG - Intergenic
1111233782 13:85380891-85380913 AAGCAGCAGCAGGGTTTGGAAGG + Intergenic
1111716292 13:91883623-91883645 TAGCTGAAGCAGAGTGAGGAAGG + Intronic
1112261613 13:97882673-97882695 GAGCAGGGTCAGGGTGAGGAGGG - Intergenic
1112290585 13:98142299-98142321 CGGCAGCTGCTGGGTGGGGACGG + Intergenic
1112504908 13:99969780-99969802 CAGCAGCAGCTGGAGCAGGAAGG - Intronic
1112870860 13:103969047-103969069 AGGAAGCAGGAGGGTGAGGAGGG + Intergenic
1112951924 13:105008754-105008776 GCACAGCAGCAGCGTGAGGACGG - Intergenic
1113458373 13:110464862-110464884 CACCAGCTGCAGGGTGCGGGGGG - Intronic
1113533453 13:111045898-111045920 AAGCAGCAGCCAGGGGAGGATGG + Intergenic
1113914538 13:113862919-113862941 CAGGAGCCGCCGTGTGAGGACGG - Intronic
1113919861 13:113901071-113901093 CAGCAGCAAAGGGGTGGGGAGGG + Intergenic
1114221580 14:20702198-20702220 GAGCAGCAGCCTGGGGAGGAGGG - Intergenic
1114354518 14:21892571-21892593 CAGAAGCAGGATGGTGAGAACGG + Intergenic
1114602267 14:23966405-23966427 CTTCAGCAGGATGGTGAGGAAGG + Exonic
1114606434 14:24001505-24001527 CTTCAGCAGGATGGTGAGGAAGG + Exonic
1114611992 14:24048799-24048821 CTTCAGCAGGATGGTGAGGAAGG + Intergenic
1114734403 14:25029124-25029146 CAGCAGCAGCAGAGTTTGAAAGG + Intronic
1114860725 14:26517228-26517250 TAGCAGCAGCAGAATGAGCAAGG - Intronic
1115203333 14:30875404-30875426 CGGCAGCAGGAGGTCGAGGAAGG + Intronic
1115542291 14:34432509-34432531 AAGCAGCAGCAGGGTTTGAAAGG + Intronic
1115695832 14:35897920-35897942 CAGCTGCAGCAGTGTGACAAAGG + Intronic
1117340613 14:54788467-54788489 CAGGAGGAGGAGGGTGGGGATGG - Intronic
1117360407 14:54967336-54967358 TAGCAACAGCAGGGCGTGGAAGG + Exonic
1118225773 14:63897783-63897805 GAGCAGGAGCAGGGGGAGCATGG - Intronic
1118766759 14:68915240-68915262 AAGAAGGAGCAGGGGGAGGAGGG - Intronic
1119262485 14:73245848-73245870 CCCCGGGAGCAGGGTGAGGAAGG - Intronic
1119320386 14:73726820-73726842 AAGCAGAGGCAAGGTGAGGAGGG - Exonic
1119599017 14:75962175-75962197 CTGTAGCAGCAGGGTTAGGGTGG - Intronic
1119756850 14:77125593-77125615 CACCAGCAGCAGGAGAAGGACGG - Intronic
1120185876 14:81393417-81393439 CAGCAGCAGCAGGAAGAGTGAGG + Intronic
1120319466 14:82941173-82941195 CAGCAATAGCAGGTTGAGGCTGG - Intergenic
1120978951 14:90274209-90274231 CAGCATGGGCAGGGTGAGGCTGG + Exonic
1121322175 14:92998364-92998386 CATCAGCAGGAGGGTGGGCATGG - Intronic
1121586654 14:95067577-95067599 CAGCAGCATGAGGGGGAGGGTGG + Intergenic
1121664263 14:95660045-95660067 CAGCAGGATCAGAGTGAGGAAGG - Intergenic
1121991683 14:98563983-98564005 CAGCACCAGAAGGATGGGGAAGG + Intergenic
1122129276 14:99595765-99595787 CAGCAGGGGCAGGGTGGGGCTGG - Intronic
1122155239 14:99746727-99746749 CACCAGCAGCAGAATGGGGATGG - Intronic
1122263191 14:100534779-100534801 CAACAGCACCAGGGAAAGGAGGG + Intergenic
1122268970 14:100559883-100559905 CAGCAGCAGCAATGTTTGGAGGG + Intronic
1122329592 14:100903662-100903684 CTTCAGCAGCAGGGTGTGGTGGG - Intergenic
1122388345 14:101364051-101364073 CAGCAACAGGGAGGTGAGGATGG - Intergenic
1122967464 14:105138041-105138063 CAGCAGCAGCTGGGTGGTGTGGG - Intergenic
1123058603 14:105584232-105584254 CAGCAGGAAGAGGGTGAGGAAGG + Intergenic
1123082934 14:105704466-105704488 CAGCAGGAAGAGGGTGAGGAAGG + Intergenic
1123800192 15:23811150-23811172 CAGCAGCAGGCGGCAGAGGAAGG + Intergenic
1124079145 15:26475161-26475183 CAGCAGCTGCAGGGTGGGTTGGG + Intergenic
1124360430 15:29032931-29032953 CAGCTGCAGCATGGGGAGCATGG + Intronic
1124367190 15:29080465-29080487 CAGCAGAGGCATTGTGAGGAAGG + Intronic
1124585685 15:31004388-31004410 CAGAAGCAGCAGGGTGGGGGTGG - Intronic
1124866143 15:33493213-33493235 AAGCATCGGCAGGGGGAGGAAGG - Intronic
1124955022 15:34354640-34354662 GGGCAGCAGCAGGAGGAGGAAGG + Exonic
1125149950 15:36520136-36520158 CATCAGCAGGAGGCTGAGGCAGG + Intergenic
1125158244 15:36614207-36614229 GAGCAGCAGCAGGGTGGGAATGG - Intronic
1125524858 15:40368393-40368415 CAGCTGCCGCAGGGCGAGGGCGG + Exonic
1125691475 15:41599527-41599549 CAGCAGAAGGAGAGTGAGGGTGG + Intergenic
1125895482 15:43298322-43298344 CAGCAGGGCCAGGATGAGGAGGG + Intronic
1126326255 15:47480647-47480669 TGGCAGAAGCAGGGTGTGGAGGG - Intronic
1126356587 15:47802431-47802453 CAGCAGCAGCAGAGTCATCAGGG - Intergenic
1126467399 15:48973384-48973406 CAGCAGCAGGAGGGATAGGTTGG - Intergenic
1127612193 15:60647836-60647858 CAGCTGCAGCAGGCTGAGGGTGG - Intronic
1127961555 15:63894405-63894427 CAGCATCAGCAGGGTCAGAGAGG + Intergenic
1127982307 15:64044373-64044395 CAGGATCACCAGGGTGAGAAGGG + Intronic
1127997636 15:64162903-64162925 CGGCAGCAGCAGGAAGAAGACGG + Exonic
1128046558 15:64623079-64623101 CTGCAGAAGCAGGTTGAGAAGGG - Intronic
1128064447 15:64755685-64755707 CAGCCACACCAGAGTGAGGAGGG + Intronic
1128248988 15:66151861-66151883 GGGCAGCAGCCGGGTGGGGAGGG - Intronic
1128715307 15:69903510-69903532 CAGCAGTAGCAGGGCCAGGAAGG + Intergenic
1128775455 15:70316721-70316743 CAGCTGCAGCATGCTGGGGATGG + Intergenic
1128842323 15:70860182-70860204 CAGCCGCAGGAGGGGTAGGATGG - Intronic
1128984057 15:72206577-72206599 CAGCAGCAAGAGGGTGGGGGTGG - Intronic
1129530624 15:76261488-76261510 CAGCTGCAGCATGGAGGGGATGG - Intronic
1129679128 15:77648048-77648070 CAGCAGCCACAGGGAGAGGGTGG + Intronic
1129747658 15:78035956-78035978 CACCAGCAGATGGGTCAGGAGGG - Intronic
1129952946 15:79608016-79608038 CAGGAACAGCAGGCTGAGGATGG - Intergenic
1131139347 15:89964439-89964461 CAGCAGCAGCAGGATCAGTCAGG - Intergenic
1131165846 15:90141775-90141797 CAGGAGCGGCAGGGGGATGAAGG + Intergenic
1131983387 15:98017408-98017430 CAGAGGGAGCAGGGGGAGGATGG - Intergenic
1132141665 15:99402262-99402284 CACCATCATCAAGGTGAGGAGGG - Intergenic
1132482895 16:175459-175481 CAGCTCCTGCAGGGTGAGGAAGG - Intergenic
1132504123 16:298232-298254 CAGGAGGAGGAAGGTGAGGACGG - Exonic
1133002410 16:2858033-2858055 CAGCAGCAGCAGGGAGGTGAAGG + Exonic
1133012539 16:2922469-2922491 CAGGGGCAGGAGGATGAGGAGGG - Intronic
1133303317 16:4795951-4795973 CAGCAGCAGCAGGAGCAGCACGG - Exonic
1133303966 16:4798662-4798684 CATCAGCTGCAGGGAGAGGCGGG + Exonic
1133366613 16:5215374-5215396 TAGAAGACGCAGGGTGAGGAAGG - Intergenic
1134084828 16:11349227-11349249 CTGCAGCAGTGGGGTGGGGATGG + Intronic
1135026842 16:19005475-19005497 CATCAGCATGATGGTGAGGAAGG - Intronic
1135312935 16:21419692-21419714 AAACATCAGCAGGGTGCGGAAGG + Intronic
1135365858 16:21851972-21851994 AAACATCAGCAGGGTGCGGAAGG + Intronic
1135445956 16:22519190-22519212 AAACATCAGCAGGGTGCGGAAGG - Intronic
1135610021 16:23858349-23858371 GAGGAGCACCATGGTGAGGAAGG + Intronic
1135953118 16:26933868-26933890 CAGCACCAGCTAGGTGAAGATGG + Intergenic
1136286850 16:29249155-29249177 CAGCAGCAGCTGGGAGCGGATGG - Intergenic
1136309600 16:29398419-29398441 AAACATCAGCAGGGTGCGGAAGG + Intronic
1136323048 16:29500200-29500222 AAACATCAGCAGGGTGCGGAAGG + Intronic
1136437732 16:30240168-30240190 AAACATCAGCAGGGTGCGGAAGG + Intronic
1136517085 16:30774741-30774763 CAGCACCTGCAAGATGAGGAAGG - Exonic
1136550446 16:30979846-30979868 CTGCAGCAGCAGCGGGAGGAGGG + Exonic
1137386499 16:48047483-48047505 AAGCAGGAGGAGGGAGAGGAAGG + Intergenic
1137938219 16:52656057-52656079 GAGCAGCAGCAGGGTGGGACTGG - Intergenic
1138346687 16:56324595-56324617 CAGCAGCAGGTGGGTGAGCAGGG - Intronic
1138521678 16:57574877-57574899 CAGCACCACCAGGTTGAAGAGGG - Exonic
1138828560 16:60351369-60351391 CAGCAGTGGCAGGGTGAGGATGG + Intergenic
1138969574 16:62128685-62128707 GAGGAGCAGCAGGAGGAGGAGGG - Intergenic
1139548691 16:67661665-67661687 GTGCAGAAGCGGGGTGAGGAGGG + Exonic
1140177660 16:72679951-72679973 CAGGGGCTGCAGGGTGAGGAGGG + Intergenic
1140219396 16:73032980-73033002 CAGCAGGAGCAGGATGGGGAAGG + Intronic
1140376159 16:74446935-74446957 CAGCAGCAGAAGGCTCAGGGAGG + Intergenic
1140854709 16:78967881-78967903 CAGTAGCTGCAGGAGGAGGAGGG + Intronic
1141793715 16:86254280-86254302 CAGCACCGGGAGGCTGAGGAGGG - Intergenic
1141992459 16:87618328-87618350 GGGCAGCAGCTGGGGGAGGAGGG + Intronic
1142041233 16:87895702-87895724 CAGAAGCAGCAGGGCGGGGGTGG - Intronic
1142092450 16:88221790-88221812 CAGCAGCAGCTGGGAGCGGATGG - Intergenic
1142134158 16:88443989-88444011 CTGAAGCAGCAGGGGGAGGCAGG + Intergenic
1142256463 16:89015920-89015942 CAGGAGCAGGGGGCTGAGGAGGG + Intergenic
1142350505 16:89577193-89577215 CAGCACCAGCTGAGTGGGGAGGG - Intronic
1142478265 17:202502-202524 CAGCAGCAAGAGAGTGAGGCGGG + Intergenic
1143078186 17:4363556-4363578 CAGCAGCAGCAATGTGTGAAAGG - Intronic
1143476505 17:7206454-7206476 CAGGAGCAGAAGGGGGTGGAGGG - Intronic
1143852952 17:9826215-9826237 CAGCAGGACCAGAGTGAGGAAGG - Exonic
1144065761 17:11622764-11622786 AAGCAGCAGCAGCCTGAGAAAGG - Intronic
1144785164 17:17827402-17827424 TGGAGGCAGCAGGGTGAGGATGG + Intronic
1144835720 17:18155681-18155703 CAGCAGCAGCACTGTGCAGAGGG + Intronic
1145312414 17:21707876-21707898 CAGGAGCAGGAGGGAGAGCAGGG - Intergenic
1145898418 17:28474196-28474218 AAGCAGCAGCAGAGTGAAGAGGG + Intronic
1145901262 17:28491792-28491814 CAGCAGCAGCAAGATGACCATGG - Exonic
1146017656 17:29246882-29246904 CAGCAGGAGCTGGGTGAGTAAGG + Exonic
1146662676 17:34675028-34675050 CATGTGCAGCAGAGTGAGGAGGG - Intergenic
1147229312 17:39005541-39005563 CAGCAGCATCATCGCGAGGAGGG + Intergenic
1147267587 17:39244268-39244290 GAGGAGCAGCAGGAGGAGGAGGG - Intergenic
1147378741 17:40039388-40039410 GAGCAGCTGCAGGGTCAGGTGGG - Intronic
1148142355 17:45337909-45337931 CCACAGCAGCAGTGTGAGGAGGG + Intergenic
1148647011 17:49225024-49225046 CAGCAGGAGGAGGAGGAGGAGGG + Exonic
1148784472 17:50139341-50139363 CAGCTCCAGCAGGGTGGGGCAGG + Intronic
1148795675 17:50195578-50195600 CAGCACCAGCAGGGCCAGGGGGG + Exonic
1148821946 17:50364945-50364967 CAGCAGCAGCAGCAGCAGGATGG - Intergenic
1149239052 17:54627120-54627142 CAGCAGCCGCAGAGTGAGGGTGG - Intergenic
1149848578 17:60021781-60021803 AGGCAGCCTCAGGGTGAGGAAGG + Intergenic
1149861591 17:60124743-60124765 AGGCAGCCTCAGGGTGAGGAAGG - Intergenic
1150576339 17:66434025-66434047 CAGGAGCAGCAGAGCCAGGATGG + Intronic
1150578608 17:66452418-66452440 GGGAAGAAGCAGGGTGAGGAGGG + Intronic
1150621047 17:66807892-66807914 CTGCAGTAGGAGGGAGAGGAAGG + Exonic
1151285753 17:73109842-73109864 CAGCAGCAGCAGCGACAGAAAGG + Intergenic
1151506091 17:74528236-74528258 CATCAGGAGTGGGGTGAGGATGG - Intronic
1151757745 17:76084207-76084229 CAGCAGCAGCAAGCAGTGGAGGG + Intronic
1151768584 17:76145167-76145189 AGGCAGCAGCTGAGTGAGGATGG + Exonic
1152079034 17:78175137-78175159 CAGCGGCACCAGGTTCAGGATGG + Exonic
1152092082 17:78252625-78252647 GTGCAGCTGGAGGGTGAGGAAGG + Intergenic
1152233028 17:79124525-79124547 CAGCAGCAGCAAGGGCTGGAAGG + Intronic
1152239282 17:79153111-79153133 CAGCTGGACCAGGGTGAGGCAGG - Intronic
1152266277 17:79296837-79296859 AAGCAGGAGGAGGGGGAGGAGGG - Intronic
1152339406 17:79716019-79716041 CAGCAGAAGCCGGGAGAGGGTGG + Intergenic
1152367215 17:79863243-79863265 CACCAGGAACAGGGTTAGGATGG - Intergenic
1152605744 17:81288883-81288905 CTGCACCAGCACGGTGAGGACGG + Intronic
1152661966 17:81546659-81546681 CAGGAGCAGCTGGGAGAGGGAGG + Intronic
1152670081 17:81598279-81598301 CAGCAGCACCAGAGGGAGGGTGG - Intronic
1152839288 17:82556546-82556568 CAGCCCCAGCAAGGTGAGGGAGG - Intronic
1152946277 17:83199169-83199191 CAGGAGCAGCTGGGAGAGGAGGG - Intergenic
1153010249 18:532178-532200 CAGCAGAAGCAGCGTGGGGTGGG + Intergenic
1153187366 18:2500397-2500419 TAGCCCCAGCAGGGAGAGGACGG + Intergenic
1153263833 18:3248257-3248279 CAGCTGCAGCAGGGGGACAACGG - Intronic
1154390622 18:13933407-13933429 CAGTTGCTGCAGGGAGAGGAAGG - Intergenic
1154529897 18:15332281-15332303 CAGCTGCAGGAGGGTGGGAATGG + Intergenic
1155087081 18:22469046-22469068 CAGCTGAAGTAGGGTGAGGCTGG + Intergenic
1155161514 18:23199916-23199938 CAGAAGCAGAAGGGAAAGGATGG + Intronic
1155399198 18:25419704-25419726 CAGAAGCAGCAGGGGCAGGATGG - Intergenic
1155654202 18:28176640-28176662 AGGCAGCAGGAGGGTGAGGCAGG - Intronic
1155807415 18:30189483-30189505 CAGCAGAAGCAGTGTTAAGAGGG - Intergenic
1156151313 18:34246754-34246776 CAGCAGCAACAGTATGGGGAGGG + Intergenic
1156181633 18:34612034-34612056 GAGCAGCAAGTGGGTGAGGAAGG - Intronic
1156302157 18:35845535-35845557 GAGCAGCAGCCTGGGGAGGAGGG - Intergenic
1156450306 18:37262883-37262905 CAGCTGCAGCAGCGTGAGGCAGG + Intronic
1156466310 18:37349782-37349804 CAGCAGCACGAGGCTGAGAAGGG + Intronic
1157103748 18:44753768-44753790 CAGTGACAGCAGGGTGAGGGAGG + Intronic
1157407902 18:47438816-47438838 CAGGAGCAGGAGAGTGAGGCAGG - Intergenic
1157590935 18:48836131-48836153 AAGCAGCTGCTGGGGGAGGAGGG - Intronic
1157687868 18:49657361-49657383 AGGCAGCAGCAGGGTGAGGATGG - Intergenic
1157710055 18:49843986-49844008 CAGCAGCACCGGGGTGGGGAAGG - Intronic
1159059267 18:63497417-63497439 CCGCAGCAGCAGGGACAGGCAGG - Intronic
1159102221 18:63970153-63970175 CAGCAGCAGCAGCAGGAGGTGGG + Exonic
1160149569 18:76388834-76388856 CAGCAACAGCCGGGGAAGGAAGG + Intronic
1160447309 18:78937571-78937593 CAGCAGAAGCCGGGTGGTGACGG - Intergenic
1160497118 18:79382234-79382256 CAGCTGCAGGTGGGAGAGGAGGG - Intergenic
1160509013 18:79442891-79442913 CAGCAGCAGCTGTGTTTGGAAGG + Intronic
1160512602 18:79460981-79461003 CAGCAGATGCAGGGCCAGGACGG + Intronic
1160695135 19:480220-480242 CAGCTGGAGCAGCGTGAGCAAGG + Intergenic
1160695974 19:484728-484750 TGGCTGCCGCAGGGTGAGGAGGG + Intergenic
1160746777 19:715380-715402 CAGCACGAGGATGGTGAGGAGGG - Intronic
1160807940 19:1000814-1000836 CCGCCGCAGCAGGCTGAGCACGG - Exonic
1160809111 19:1005450-1005472 CAGCACCAGCAGGCAGAAGATGG - Exonic
1160975796 19:1791856-1791878 CAGCAGCTGGTGGGGGAGGAGGG + Exonic
1161009973 19:1955294-1955316 CAGCAGCAGCAGCAGCAGGAGGG - Intronic
1161062089 19:2220245-2220267 CAGCAGCAGCAGAGTCCTGAGGG - Intronic
1161085443 19:2332969-2332991 GAGCAGGAGGAGGGTGGGGATGG + Intronic
1161085464 19:2333030-2333052 GAGCAGGAGGAGGGTGGGGATGG + Intronic
1161085482 19:2333090-2333112 GAGCAGGAGGAGGGTGGGGATGG + Intronic
1161085502 19:2333151-2333173 GAGCAGGAGGAGGGTGGGGATGG + Intronic
1161085520 19:2333211-2333233 GAGCAGGAGGAGGGTGGGGATGG + Intronic
1161265419 19:3361305-3361327 CAGCAGCACAGGGGTTAGGACGG + Intronic
1161345959 19:3768823-3768845 CGGCTGGAGCAGAGTGAGGAGGG - Intergenic
1161427280 19:4210476-4210498 TGGCTGCAGCAGGGTGGGGAGGG - Intronic
1161649887 19:5477958-5477980 TGGCTGCAGCAGAGTGAGGAGGG - Intergenic
1161756423 19:6137447-6137469 TGGCTGCAGCAGAGTGAGGAGGG + Intronic
1162054500 19:8054453-8054475 CAGCAGGAGCAGGGAAAGGGAGG - Intronic
1162371640 19:10283580-10283602 GAGCAGCACCACGGTGAGGTTGG - Exonic
1163438871 19:17311532-17311554 CAGGGGCCTCAGGGTGAGGAGGG - Intronic
1163487191 19:17595060-17595082 GAGCAGCAGCCTGGGGAGGAGGG - Intergenic
1163611643 19:18304803-18304825 CAGCCCCAGTTGGGTGAGGAGGG + Intergenic
1163643094 19:18472966-18472988 TAGAAGGAGCAGGGTGAAGATGG + Intronic
1163689875 19:18732683-18732705 CAGCAGCAAAAGGCAGAGGAGGG + Intronic
1163834264 19:19563554-19563576 CAGAGTCCGCAGGGTGAGGAAGG + Exonic
1164501835 19:28826967-28826989 CAGCAGCAGCAGGGTCACCCGGG + Intergenic
1165023526 19:32942993-32943015 CAGCAGCTGGAGGCTGAGGCAGG - Intronic
1165059133 19:33196197-33196219 CAGCAGCAGCAGAGGCAGGAGGG - Intronic
1165062220 19:33210503-33210525 CAGCAGCAGCAGGCCCAGGATGG + Exonic
1165377006 19:35449875-35449897 CAGCAGCAGCAGGAGGAGGTCGG - Exonic
1166017631 19:39994857-39994879 CAGGAGCAAGAGAGTGAGGAGGG - Intronic
1166061534 19:40328608-40328630 CAGCAGTCTCAGGGTCAGGATGG + Intronic
1166369683 19:42293887-42293909 GAGCAGCTGCAGGCTGAGGCGGG + Intronic
1166643558 19:44514355-44514377 AAGGATCAGGAGGGTGAGGAAGG + Intronic
1166748336 19:45152500-45152522 CAGCAGCAGCAGGGGGACTTTGG - Exonic
1166816672 19:45550512-45550534 CCCCAGCTGCAGAGTGAGGAGGG - Intronic
1167247622 19:48383242-48383264 CAGCAGCGGGAGGCAGAGGAAGG - Exonic
1167291339 19:48626700-48626722 CAGCTACAGGAGGGTGAGGCAGG + Intronic
1167435362 19:49475692-49475714 CAGCAGCAGCAGGAGGAGATAGG - Exonic
1167443681 19:49525045-49525067 CAGCAGCAGCAGCAGCAGGATGG - Intronic
1167804181 19:51768314-51768336 CAGCCTCAGCATTGTGAGGAAGG - Intronic
1168000563 19:53442614-53442636 GAGCAGCAGCAGGGTGGGACTGG - Intronic
1168005058 19:53480098-53480120 GAGCAGCAGCAGGGTGGGACTGG - Intronic
1168104316 19:54157206-54157228 CAGTAACAGCAGGGGAAGGAGGG + Intronic
1168514846 19:57002573-57002595 AAACCGCAGCAGGGTGCGGAAGG + Intergenic
925118458 2:1399291-1399313 CAGCATCAGCAGCCTGACGATGG + Intronic
925142364 2:1558982-1559004 CGGGAAGAGCAGGGTGAGGAGGG + Intergenic
925177662 2:1796704-1796726 CAGCAGGAGCAGAAGGAGGATGG - Intronic
925234478 2:2266054-2266076 CAGCATCAGCAGGCTGTGAAGGG - Intronic
925237646 2:2293456-2293478 CTGCAGGAGCAGGGCGTGGAGGG + Intronic
925362982 2:3292438-3292460 CCGCAACAGCATGGTGAGCATGG - Intronic
925759206 2:7168159-7168181 CTGCAGCAGGAGGGTGAGAGTGG + Intergenic
925913589 2:8588644-8588666 GAGCAGCAGCATGGTCAGGATGG - Intergenic
925991271 2:9256908-9256930 CTGCAGCAGGAGGATCAGGAAGG - Intronic
927667896 2:25044811-25044833 GGGCAGAGGCAGGGTGAGGAGGG - Intronic
927878527 2:26674612-26674634 CACCAGCAGAAGGGTGGGGCTGG + Intergenic
927887570 2:26728093-26728115 CAGCACCACGAGGTTGAGGAAGG - Exonic
928285671 2:29988080-29988102 CAGCAGTAGGGGAGTGAGGAAGG - Intergenic
928325881 2:30319167-30319189 CAGCAGCAGCAGAAAGAGGTGGG + Intronic
928620882 2:33086446-33086468 TAGCAGCAGCAGGCCCAGGAGGG + Intronic
928697058 2:33859985-33860007 CAGCCGCAGGAGGGGAAGGAAGG - Intergenic
928706248 2:33952762-33952784 CAGCGGGGGCAGGGTGTGGAGGG + Intergenic
929590562 2:43143061-43143083 CAGCAGCAGCAGCAGGAGGGAGG - Intergenic
930019055 2:46990099-46990121 CAACAGCAGCAGGCTGAAGAGGG - Intronic
930092583 2:47541987-47542009 CAGCAGCAGCAGCGGCAGCAGGG + Intronic
930096428 2:47570252-47570274 CAGCAGCAGCAGCAGCAGGAGGG + Exonic
930096483 2:47570395-47570417 CGGGAGCAGGAGCGTGAGGATGG + Exonic
930103118 2:47618140-47618162 AGGCACCAGCTGGGTGAGGAGGG + Intergenic
930686899 2:54319128-54319150 CATCATCAGCAGGGTGAATAGGG + Intergenic
930769794 2:55119929-55119951 CAGATGCAGGAGGGTGAAGATGG + Intergenic
930897926 2:56467111-56467133 CAGCTAAAGCAGGGTGAGAAGGG + Intergenic
931426794 2:62178756-62178778 CAGCAGCAGGAGAGTAAGGGAGG + Intergenic
931936006 2:67197190-67197212 CTCCAACAGCAGGTTGAGGATGG - Intergenic
932393827 2:71424026-71424048 CAGCAACAATAAGGTGAGGAGGG + Exonic
932435208 2:71699328-71699350 CAGCCCCAGCTGGGGGAGGAGGG - Intergenic
932438489 2:71717096-71717118 CAGCTGGAGCAGGGTGAGCAAGG - Intergenic
932463206 2:71896682-71896704 CCCCAGCAGCAGGGACAGGATGG + Intergenic
932475689 2:72004337-72004359 CAGCAGCAGCAGGGATTGCAGGG + Intergenic
932534772 2:72581675-72581697 CAGCAGGGGCAGGGTGCGGGAGG - Intronic
932598123 2:73106900-73106922 GAGAAGCTGCAGGGTGGGGAGGG - Intronic
932752169 2:74378218-74378240 CAGCGGCAGCAGGATGAGTGCGG - Exonic
934161657 2:89255241-89255263 CAGCTGAAGCAGGATGAGCAGGG + Intergenic
934205627 2:89927174-89927196 CAGCTGAAGCAGGATGAGCAGGG - Intergenic
934473477 2:94576891-94576913 CAGGAGCATCAGAGAGAGGAGGG + Intergenic
934573944 2:95388997-95389019 GAGGACCAGCAGGCTGAGGAGGG + Intergenic
934702170 2:96451334-96451356 TAGGAGCATGAGGGTGAGGAGGG - Intergenic
934885815 2:98023311-98023333 CAGCAGGAGGTGGGTGAGCAAGG + Intergenic
935632693 2:105224860-105224882 CAGCAGCACGAGGAGGAGGAGGG - Intergenic
935860008 2:107319400-107319422 TAGCAGCAGCAGGAAGAGAAAGG - Intergenic
935976587 2:108584750-108584772 GAGCAGCAGCATGGAGATGAGGG + Intronic
936044035 2:109172377-109172399 CTCCAGGAGCAGGGAGAGGACGG - Intronic
936232113 2:110712168-110712190 CCAGACCAGCAGGGTGAGGAGGG - Intergenic
936598128 2:113868896-113868918 CAGCAGCAGCAGCAGAAGGAAGG + Intergenic
936664134 2:114575007-114575029 TAGCAACAGCAGGGAGACGAAGG + Intronic
936847282 2:116852601-116852623 CAGCTGCAGCAGGGTGCCCATGG - Intergenic
937027358 2:118710753-118710775 CAGCAGCAGCAGGGGGTGGCAGG - Intergenic
937127409 2:119483260-119483282 CAGCAGCTCAAGGGTGAGTAGGG + Intronic
937369340 2:121286650-121286672 CAGGAACAGCAGAGTGAGGGAGG - Intergenic
937387359 2:121447916-121447938 CAGCTGCAGCAGTGTGATGGTGG - Intronic
937886644 2:126903820-126903842 CAGCAGCAGCAGGGAGACTCAGG + Intergenic
938260397 2:129891752-129891774 CAGCAGCAGCAGGAGGAGGATGG - Intergenic
938293816 2:130164313-130164335 AAGAAGCAGCAGGCTGAGCAGGG + Intronic
938396176 2:130950102-130950124 CAGCTGAAGGAGGATGAGGAAGG + Intronic
938462728 2:131508649-131508671 AAGAAGCAGCAGGCTGAGCAGGG - Intergenic
938487206 2:131723546-131723568 CACCAGCAGCCTGGGGAGGAGGG - Intronic
938528994 2:132163721-132163743 CAGCTGCAGGAGGGTGGGAATGG + Intronic
938581654 2:132651970-132651992 CAGCAGCAACATGGGCAGGAAGG + Intronic
939376860 2:141379958-141379980 CTTCAGGAGCAGGCTGAGGAAGG - Intronic
940640929 2:156343076-156343098 CCGTAGTAGCAGCGTGAGGAAGG + Intergenic
940672361 2:156686336-156686358 TAGCAACAGCAAGGTGAGGATGG + Intergenic
941101802 2:161304825-161304847 CAGTAACAGAAGGGAGAGGAAGG - Intergenic
942985413 2:182134781-182134803 GAGGAGCAGCAGGATGAGGGTGG + Intergenic
943187762 2:184634533-184634555 CAGAAGCAGAGGGGTGAGGAGGG + Intronic
943273078 2:185832303-185832325 CAACAGCAGCAGATTGAGCAGGG + Intronic
943685474 2:190813226-190813248 CAACAGCAGGAGAGTGAGGATGG + Intergenic
943811662 2:192195344-192195366 CAGCAGCAGCAGGGCAGAGAGGG + Exonic
944586976 2:201181141-201181163 ATGCTGCAGCAGAGTGAGGAGGG - Intergenic
944634106 2:201657832-201657854 GAGCATGAGCAGGGTGAAGAAGG - Intronic
944703500 2:202265931-202265953 CAGCACCAACATGGTGAGGCCGG - Exonic
944988959 2:205212490-205212512 CAGCCAGAGTAGGGTGAGGAAGG + Intronic
946306626 2:218860057-218860079 CAGCAGCAGCAGCCCGAGGCGGG - Exonic
946366136 2:219250223-219250245 CAGCAGCAGCATGAAGGGGAAGG + Exonic
946495731 2:220193395-220193417 CACCAGGAGCAGGGAGAGGCCGG + Intergenic
946692363 2:222319322-222319344 CAGCACCACCATGGAGAGGAAGG + Intergenic
947120327 2:226807633-226807655 CAGTGGGAGCAGAGTGAGGAAGG + Intergenic
947375362 2:229489812-229489834 CAGCAGGATAAGGATGAGGAAGG + Intronic
947399054 2:229714358-229714380 CAGCAGCAGCAGGGCCAGCGCGG + Exonic
947488401 2:230573136-230573158 GAGCAGCAGCAGGGTGGGACTGG + Intergenic
948080056 2:235198491-235198513 CAGCAGCCCCAGCCTGAGGAGGG - Intergenic
948506425 2:238430251-238430273 AAGCAGCAGCAGGGTTAGAGAGG - Intronic
948599160 2:239098386-239098408 CAGGAGCAGCAGCGAGAGGATGG - Intronic
948624041 2:239256682-239256704 CAGCAGCAGAAGGGACTGGATGG + Intronic
948882771 2:240868921-240868943 CAGCAGGAGCTGGTTGGGGATGG - Exonic
1168845065 20:938873-938895 CAGCTGCAGGAGGGTCAGAAAGG - Intergenic
1169424427 20:5485229-5485251 CAGCAGCTGCAGGGAGGGGGCGG - Intergenic
1169898969 20:10534071-10534093 CAGCCGAGGCAGGGTGAGGGTGG + Intronic
1170571736 20:17636572-17636594 CAGCAGCTGCAGGGCAAGGTGGG - Exonic
1170779057 20:19407248-19407270 CAGCAGCAGCACTAAGAGGATGG + Intronic
1170918751 20:20655553-20655575 CAGCAGCAGGAGGGTCAGTTTGG + Intronic
1171165626 20:22967675-22967697 CAGCTGTAGTAGGGTGAAGAGGG - Intergenic
1171272320 20:23826628-23826650 CAGGAGCAGCAGGGTGCACAGGG + Exonic
1171278760 20:23879644-23879666 CAGCAGCAGTGGGGTGTGCATGG + Exonic
1171278771 20:23879722-23879744 AAGCAGCAGAAGGCTGAGGCAGG + Exonic
1171877708 20:30593827-30593849 CTGCAGGAGCTGGGTGGGGAAGG + Intergenic
1172985666 20:38986973-38986995 CAGCAGCCCCAGGCTCAGGAGGG - Intronic
1173257675 20:41406466-41406488 CAGCAGCATCAGCGAGCGGAAGG + Intronic
1173322974 20:42005978-42006000 CAGCAGCAGCATGTGGAGTAAGG - Intergenic
1173620116 20:44430115-44430137 CAGCAGCAGAAGGAGGAGCAAGG - Exonic
1173663570 20:44750555-44750577 CAGGACCACCAGGTTGAGGAAGG - Exonic
1173909202 20:46651528-46651550 CAGGAGGAGCAGGGAGAGGGCGG - Intronic
1174202219 20:48814693-48814715 CACCTCCAGCAGAGTGAGGATGG + Intronic
1174293004 20:49522136-49522158 CAGCTGAAGCAGAGTGAGGGAGG - Intronic
1174346389 20:49933205-49933227 CAGCAGGAGGAGGCTGAGGCGGG - Intergenic
1174373674 20:50111795-50111817 CAGCAGCGGCAGTGTTGGGAAGG - Intronic
1174584699 20:51599093-51599115 CAGCAGAAGCAGAATGAAGATGG - Exonic
1175315736 20:58045326-58045348 GGGCAGCAGGAGGATGAGGAAGG + Intergenic
1175498893 20:59435408-59435430 AAACAGCAGCAGGATGAGGAGGG + Intergenic
1175649866 20:60710639-60710661 AAGCAGCAGCAGGGTTTGAAAGG + Intergenic
1175692965 20:61079285-61079307 CAGCGGCAGGAGGGTCAGGAGGG - Intergenic
1175779669 20:61674366-61674388 AAGCAGCATCAGGCTAAGGAGGG + Intronic
1175834484 20:61984907-61984929 CAGCAGGAGGAGGGCGAGCAAGG + Intronic
1176057323 20:63155593-63155615 CAGCAGGAGCAGGCTCAGGACGG + Intergenic
1176767514 21:13036195-13036217 CAGCTGCAGGAGGGTGGGAATGG - Intergenic
1176901611 21:14449053-14449075 CAGTAGGGGCAGAGTGAGGAGGG - Intergenic
1178154730 21:29838499-29838521 GAGCAGCAGAAGAGTGAGTAGGG - Intronic
1178270059 21:31181481-31181503 CAGAAGGAGCGGGGAGAGGAAGG + Intronic
1178626825 21:34225316-34225338 CAGCAGGAGGAGGGAGAGGTGGG + Intergenic
1179091034 21:38265977-38265999 CACCAGCAGGAGGGTGCGGGAGG + Intronic
1179196818 21:39171820-39171842 CACCAGCATCAGGGTGACCAGGG + Intergenic
1179598825 21:42461906-42461928 CATCAGAGGCAGGGTGAGGAGGG + Intergenic
1179613993 21:42569930-42569952 CAGCAGCAGCAGCGTGGAGCTGG - Intronic
1179904313 21:44414343-44414365 CCGCAGCAGCACCGTGAGCAGGG - Intronic
1179926319 21:44536217-44536239 CAGGAGCAGCAGCCTGAGGATGG - Intronic
1180000148 21:44991827-44991849 CAGCAGCTGCTGGGTGTGCAGGG + Intergenic
1180030910 21:45206960-45206982 CAGCAGCAGCAGAGAGAGCCTGG + Intronic
1180255435 21:46624279-46624301 CAGCAGCAGCAAGTTCAGGGTGG - Intergenic
1180855394 22:19041874-19041896 CAGCAGTGACAGGATGAGGAAGG + Exonic
1180863897 22:19104887-19104909 CAGCAGCAGCAGAGGGGAGAAGG + Intronic
1181113162 22:20613600-20613622 AAGAAGCAGCAGGCTGAGCATGG + Intergenic
1181171927 22:21014832-21014854 CAGCAGCAGCAGGGCGGGGAGGG - Intronic
1181572022 22:23772911-23772933 CAGCAGCATCGGGGGCAGGAGGG - Exonic
1181694521 22:24586189-24586211 GAGCAGGAGCTGGGTGAGGCGGG + Exonic
1181964698 22:26648160-26648182 CCACTGCAGCAGGGAGAGGATGG + Intergenic
1182041024 22:27239234-27239256 CAGCTGCAGCTGGAGGAGGAAGG + Intergenic
1182395884 22:30035685-30035707 CAGAAGCAGGAGGAAGAGGAAGG - Intergenic
1182460747 22:30481882-30481904 CAGCAGCAGCAGGAGCAGGAGGG + Intergenic
1182510108 22:30813589-30813611 CTGCAGCAGCTGGGTGAGGATGG - Intronic
1182518992 22:30874777-30874799 CAGTACCTGAAGGGTGAGGAAGG - Intronic
1182550833 22:31100049-31100071 CAGCAGCGGGGGGGTGGGGATGG - Intronic
1182994325 22:34798856-34798878 CTGCAGTAGCTGGGGGAGGAGGG + Intergenic
1183072900 22:35408646-35408668 CATCTGGAGCAGGGTGAGTAGGG + Intronic
1183255965 22:36762403-36762425 GGGCTGCAGCAAGGTGAGGATGG + Intronic
1183542008 22:38434901-38434923 CAGCAGCGGCCTGGTGAGGAAGG - Intronic
1183733080 22:39629188-39629210 GTGGAGCACCAGGGTGAGGACGG - Intronic
1183933652 22:41249747-41249769 CACGAGCAGCCTGGTGAGGAAGG + Exonic
1184104533 22:42359804-42359826 CAGGAACAGCATGGTGAGCAGGG - Intergenic
1184189118 22:42883193-42883215 TGGCAGGAGCAGGGTGAGGCTGG - Intronic
1184235052 22:43178938-43178960 CAGCAGCAGATGGGAGAGGAGGG + Intronic
1184250319 22:43256500-43256522 CAGCAGGGGCTGGGTAAGGAAGG + Intronic
1184274306 22:43401415-43401437 CAGGAGTAGGAGGGTGAGGTGGG + Intergenic
1184299682 22:43550112-43550134 AAGCAGCAGCAAGCTGAGGTGGG + Intronic
1184701992 22:46181369-46181391 CAGCTGCAGCAGGCTGTGGCAGG + Intronic
1184714454 22:46273033-46273055 AGGCTGCAGCAGGGTGAGAAGGG - Intronic
1184773961 22:46613976-46613998 CGGCTGCAGCAGTGTGAGGAGGG + Intronic
1184933723 22:47702246-47702268 CAGCAGCAGCGGGGTGGGGAGGG - Intergenic
1184964261 22:47956619-47956641 CACCAGCAGCAGGGTGATCATGG - Intergenic
1185001021 22:48245842-48245864 CAGCAGTAGGAGGCTGAGGCGGG + Intergenic
1185007886 22:48295050-48295072 CAGCAGCAGAAGCGTGTCGAAGG - Intergenic
1185097086 22:48815597-48815619 AAGCAGCAGCAGGGTTTGGGTGG + Intronic
1185117813 22:48947904-48947926 CAGAACCTCCAGGGTGAGGACGG + Intergenic
1185121407 22:48973814-48973836 CAGCAGGAGCAGAGTGGGGACGG + Intergenic
1185182218 22:49369953-49369975 CAGGAGCACCAGGGTGTGCATGG + Intergenic
1185330126 22:50248698-50248720 CTGCAGCAGCTGTGTGAGGTGGG + Exonic
1185344915 22:50306936-50306958 CTGCAGGAGCAGGGTGCGGAGGG + Intronic
1185363019 22:50420443-50420465 CAGCAGCAGAAGAGTGAGTTCGG + Intronic
949934084 3:9102921-9102943 CAGCAGCAGCAGGCGGGGGCTGG + Intronic
950494282 3:13324376-13324398 CGGCAGGAGCACTGTGAGGAAGG - Intronic
950660100 3:14461870-14461892 CAGCAGCAGCAGGGGGAGCCAGG - Intronic
950769945 3:15303314-15303336 AAGCCGAAGCAGGCTGAGGAAGG + Intronic
951525649 3:23650405-23650427 GAGCAGCACCAGGGAAAGGAAGG - Intergenic
951614744 3:24529896-24529918 CTGTAAAAGCAGGGTGAGGAGGG - Intergenic
951932325 3:27982180-27982202 CAGGAGCATCAGTGTGAGGAAGG - Intergenic
952113250 3:30148937-30148959 TAGCCTGAGCAGGGTGAGGAGGG + Intergenic
952179659 3:30904451-30904473 CAGCAGAAGAGGGCTGAGGATGG - Intergenic
952269351 3:31817038-31817060 CAGCCAGAGCAGGGAGAGGATGG - Intronic
952273138 3:31852037-31852059 CAGCAGCTGCAGGGTGAAAAAGG + Intronic
952356021 3:32584836-32584858 CAGCTGGAGCAGTGAGAGGAGGG - Intergenic
952644648 3:35640087-35640109 CAGCAGCAGCAGGGGCAGCGGGG + Intronic
953091153 3:39727184-39727206 CAGTAGCAAGAGAGTGAGGATGG + Intergenic
953121169 3:40044057-40044079 AAGCAGAAGCTGGATGAGGAAGG + Exonic
953123820 3:40071879-40071901 CAGCACCTGCAGGGTCACGAGGG + Intronic
953415368 3:42712600-42712622 CAGCAGCAGGAAGGGGAGAAGGG - Intronic
953656775 3:44860712-44860734 GAGAAGCAGCATGGTGTGGAAGG + Intronic
953782235 3:45881457-45881479 CAGCAGCAGCAGGAATGGGAGGG - Intronic
954256758 3:49412536-49412558 CAGCAGCAGCAGCTTGAAGAGGG - Exonic
954437156 3:50502538-50502560 CAGCAGCAGCAGGCGCAGGCAGG + Intronic
955046211 3:55362752-55362774 CAGGAGCAGCTGGGTCTGGAGGG - Intergenic
955358349 3:58250556-58250578 CAGAAACAGGAGGGAGAGGAAGG + Intronic
955682310 3:61514904-61514926 CAGGAGCAAGAGGGTGTGGAGGG - Intergenic
956106425 3:65823531-65823553 CAGGAGAAGCAGGCTGTGGAAGG - Intronic
956975189 3:74570737-74570759 CAGCAGCTGCCGGCTGAGGGAGG - Intergenic
957699636 3:83691969-83691991 CAGCAAAAGCAGTGTTAGGAGGG + Intergenic
957723901 3:84039441-84039463 CAGCAGCAGCAGTACTAGGAAGG + Intergenic
958756999 3:98260989-98261011 CAGCAGCAGCATGGTGCTGAGGG - Intergenic
959585744 3:108023596-108023618 CAGCACCAGCAGAGTGGGGCAGG - Intergenic
959909202 3:111744318-111744340 CACCAGCAGCAATGTGCGGAAGG - Intronic
960260874 3:115567047-115567069 CATCAGCAGTTGGGTGATGAAGG + Intergenic
960639550 3:119812803-119812825 CTGCAGCTGCGGGGGGAGGATGG + Exonic
960687420 3:120307929-120307951 CAGCAGCAGCAAGGAATGGAGGG + Intergenic
960845557 3:122001399-122001421 AATCAGCAGCAGGAGGAGGAGGG + Exonic
961107632 3:124255728-124255750 CAGATGGAGCAGGGTGGGGAGGG + Intronic
961602686 3:128073349-128073371 CAGCAGGAGCAGGCTGGGGGCGG - Intronic
961988117 3:131158689-131158711 CAGCAGCAGCAGAGACAGAATGG - Intronic
962264818 3:133937345-133937367 CAGCAGGAGCAGGGTCTGAAGGG + Intronic
962354086 3:134678756-134678778 TAGCAGCAGCACAGTGAGGTGGG - Intronic
963054537 3:141174925-141174947 CAGCAGCTGCAGGCTGGGGCAGG + Intergenic
963674225 3:148288179-148288201 CAGCAGCATCAATGTTAGGATGG - Intergenic
964490145 3:157227574-157227596 CAGGAGCAAGAGAGTGAGGAGGG + Intergenic
964546831 3:157843566-157843588 CAGCAGCAGCAAAATGAGCAAGG + Intergenic
966863552 3:184243814-184243836 CAGCAGGAGCAGGGTGAGGTGGG + Exonic
967815689 3:193796278-193796300 CAGCAACAGCCAGGTGAAGAGGG - Intergenic
968332697 3:197885170-197885192 GAGCAGCAGGAGGGCGGGGAGGG - Intronic
968489972 4:884718-884740 CAGCAGCAGCTGTGTAAGAATGG + Intronic
968490681 4:889125-889147 CAGCAGGAGCAGGGAGTGGGTGG + Intronic
968903590 4:3442054-3442076 CAGCAGGAGGAGGAGGAGGAAGG - Exonic
968961953 4:3750171-3750193 CTGCAGCAGCAGGGACAGAAGGG + Intergenic
969271819 4:6108226-6108248 CAGAAGCAGCAGAGTGAGGCTGG + Intronic
969448770 4:7260830-7260852 GAGCAGCAGCAGGAGGAAGAGGG - Intronic
970221934 4:13820740-13820762 CAGCACCAGCGAGGTGGGGAAGG + Intergenic
970601137 4:17641978-17642000 CAGCCGCAGTAGGGGGAGGGGGG + Intronic
971261964 4:25065474-25065496 AGGCAGCAGCAGGGTGTGGAGGG - Intergenic
972163423 4:36253326-36253348 AAGGAGAAACAGGGTGAGGAGGG - Intergenic
972541575 4:40043701-40043723 CGGCAGGAGCAGGAGGAGGAGGG - Intergenic
974568684 4:63613474-63613496 CAGCAGCGGTGGGGTGGGGATGG + Intergenic
975496123 4:75037675-75037697 CAGCAGCAGTGTGGTGTGGAGGG + Intronic
975723486 4:77270279-77270301 AAGCAGGACCAGGGAGAGGAAGG + Intronic
976823944 4:89238133-89238155 CAGCAGCTGGAGGGAGAGTATGG + Exonic
977317434 4:95467988-95468010 GAGGAGCAGGAGGATGAGGAGGG + Intronic
978503594 4:109433990-109434012 CACCAGCAGAACGGTGAGGCGGG + Exonic
979541802 4:121892075-121892097 AAGCAGGAGCTGGGAGAGGAAGG + Intronic
980101939 4:128550573-128550595 CAGAAGCAGCAGGGATAAGAGGG + Intergenic
980111323 4:128640094-128640116 CCACAGCAGCAGGCTGAGGCAGG - Intergenic
980282146 4:130736451-130736473 CTGCAGCAGCAGGGGAAGCATGG + Intergenic
981439224 4:144763870-144763892 AAGCAGCAGCAGGGTTGGAAAGG - Intergenic
982065585 4:151651632-151651654 CAGGAGAAGCCTGGTGAGGAGGG + Intronic
983124374 4:163932386-163932408 AAGCAGCAGCAGGGTTTGAAAGG - Intronic
983238646 4:165207490-165207512 CAGCAGCAGCAGCAGGAGGAAGG + Intronic
983659490 4:170118117-170118139 GAGCAGCAGCCTGGGGAGGAGGG - Intergenic
984291915 4:177807051-177807073 CAGAAGCAGCACGGTGAGAATGG - Intronic
985369501 4:189270572-189270594 AAGCAGCAGCAGGGTTAGAGAGG + Intergenic
985736203 5:1584942-1584964 CAGAAGCATCAGGGTAACGATGG - Intergenic
985756189 5:1719930-1719952 CAGCAGGAGCAGGATGTGGCAGG + Intergenic
985843488 5:2327160-2327182 CAGCAGCAGGAGGGTGGGTAGGG + Intergenic
985849527 5:2378601-2378623 CCACACCAGCAGGGAGAGGAGGG - Intergenic
985947774 5:3200292-3200314 CAGCAGCAGGAGGGTGTGACCGG - Intergenic
986178995 5:5376130-5376152 CAGCAAGAGCAAGGTGAGGTGGG + Intergenic
986284220 5:6347992-6348014 CCATTGCAGCAGGGTGAGGAGGG + Intergenic
986727226 5:10608056-10608078 TAGCAACAGCAGGCTGAGTACGG + Intronic
987095767 5:14548016-14548038 CAGCAGCAGCAGGGTTTGAGAGG - Intergenic
988274566 5:29064365-29064387 AAGCAGCAGCAGGGTTTGAAAGG + Intergenic
988575335 5:32417666-32417688 CAGCAACAGAAGGCTGAGGTTGG + Exonic
988717607 5:33843393-33843415 GAGCCCAAGCAGGGTGAGGAGGG + Intronic
988861224 5:35282001-35282023 CAGCAGGAGGAGGGTAAGAATGG + Intergenic
989367951 5:40677269-40677291 CAGCAGGAGTGGGGTGAGAAAGG - Intergenic
990825520 5:59893682-59893704 CAGCAGCAGCAGCATCAGGAAGG - Exonic
990998421 5:61757172-61757194 CATCAGCACAAGGGTGAAGAGGG + Intergenic
991054483 5:62306436-62306458 CAGCAGCAGCGGGCCGAGGGAGG - Exonic
992197830 5:74357259-74357281 CCTCAGAAGCAGAGTGAGGAGGG - Intergenic
992481580 5:77157029-77157051 CAGCTTCAGCAGGGTGATCATGG + Intergenic
992508419 5:77410049-77410071 CATCAGCAGCAGGGGAGGGAGGG - Intronic
992663666 5:78985165-78985187 CAGCAGCAGCGGGAGGACGACGG + Exonic
992783151 5:80146204-80146226 GAGCAGCAGCCGGGGAAGGAGGG - Exonic
993013318 5:82508543-82508565 GAGCCCCAGCAGGGTGAGAAGGG - Intergenic
994497794 5:100535577-100535599 CAGCAACAGCAGGAGGAGGACGG - Exonic
996044466 5:118854942-118854964 CAGCAGCAGGAGGCCGAGGTGGG + Intronic
996220310 5:120924131-120924153 GAGTTGCAGCAGGGTGAGGAAGG - Intergenic
996352090 5:122555421-122555443 AAGCAGCAGCAGGGTTTGAAAGG + Intergenic
997091161 5:130860269-130860291 AAGCAGCAGTAGGATGAGGGAGG - Intergenic
997887326 5:137641854-137641876 CAGCAGCAGCAGCTCGAGGCTGG - Intronic
998098785 5:139414607-139414629 CAACAGCAGCTGGGAGAGAATGG + Intronic
998335359 5:141366447-141366469 CACCAGCAGCACGATGACGAAGG - Exonic
998454966 5:142264836-142264858 CAGCAGCAGCAGGAGGTGAAGGG - Intergenic
999232187 5:150068248-150068270 CAGCAGCAGCAAGGCCATGATGG + Exonic
999254266 5:150201114-150201136 CAGCATGAGCAGGATGAGGTAGG - Exonic
999287381 5:150402258-150402280 GAGAAGCAGCAGGTTGAGGTTGG + Intronic
999981068 5:156958241-156958263 CAGCCTCGGCAGGGTGAGGGAGG + Intronic
1000253257 5:159514818-159514840 CTGCAGCAACAGGGTGGGGTGGG - Intergenic
1000507177 5:162135785-162135807 AAGAGGAAGCAGGGTGAGGAAGG + Intronic
1000721156 5:164709078-164709100 TAGCAGCAGCAAGCTGAGGCCGG - Intergenic
1000816328 5:165927134-165927156 GAGCTGGAGCAGGGTGAGGGGGG - Intergenic
1001106535 5:168859157-168859179 CGGCAGAAGCAGGGGGTGGAGGG + Intronic
1001599347 5:172918944-172918966 CAGCAGCCGCAGCGTGATGAGGG - Intronic
1001751838 5:174137253-174137275 CAGCTGTAACAGGGTGAGGGTGG + Intronic
1001917181 5:175571590-175571612 ATGCAGGAGCAGGGAGAGGAAGG - Intergenic
1002063039 5:176637723-176637745 CAGCAGAGGGAGGGAGAGGAGGG + Intronic
1002169117 5:177365711-177365733 CAGCAGGGGCTGGGGGAGGAGGG + Intronic
1002321517 5:178378729-178378751 CACCTGCCTCAGGGTGAGGAAGG + Intronic
1002468109 5:179417891-179417913 CAGAAGCAGCTGGGTGACCACGG + Intergenic
1002667708 5:180838208-180838230 GAGCCCAAGCAGGGTGAGGAGGG + Intergenic
1003392674 6:5727095-5727117 CAGTAACAGCCCGGTGAGGAAGG - Intronic
1003414930 6:5898959-5898981 CAGCAGCAGAAGGTGGAGGAAGG - Intergenic
1003529272 6:6924598-6924620 CAGGAGCAGGAGAGAGAGGAGGG - Intergenic
1003550934 6:7101461-7101483 CTGGAGCAGCAGAGGGAGGAGGG - Intergenic
1003592890 6:7450474-7450496 CAGCAGCAGCAGCAGGAGAAAGG + Intergenic
1003763016 6:9203141-9203163 CCTCTGCAGCAAGGTGAGGATGG - Intergenic
1003974707 6:11331359-11331381 CTGAAGCAACAGGGTGAGGCGGG + Intronic
1004004788 6:11628649-11628671 CAGCAGCAGCAGCTACAGGAAGG - Intergenic
1005019480 6:21404056-21404078 CAGCAGCAGCTGGAACAGGAGGG - Intergenic
1005168686 6:22956178-22956200 TAGCAGAAGCTGGGGGAGGAGGG + Intergenic
1005233128 6:23727855-23727877 CAGCAGAGGCGGGGTGCGGAGGG - Intergenic
1006133232 6:31880979-31881001 GGGGAGCAGCAGGGTAAGGAGGG + Intronic
1006223842 6:32519452-32519474 CAGCATCACCAGGGTCTGGAAGG + Exonic
1006227766 6:32554772-32554794 CAGCATCACCAGGGTCTGGAAGG + Intronic
1006230437 6:32581639-32581661 CAGCATCACCAGGGTCTGGAAGG + Exonic
1006357371 6:33567894-33567916 CACCCCCAGCAGGGTGGGGAGGG - Intergenic
1006449156 6:34096029-34096051 CAGCAGCAGGAGGGGAGGGAGGG + Intronic
1006451472 6:34108072-34108094 CAGCACAGGCTGGGTGAGGAGGG + Intronic
1006457897 6:34142542-34142564 CCCCCGCAGCAGGGTGGGGATGG + Intronic
1006735473 6:36269960-36269982 CCGCAGCAGCATGTTGGGGAGGG + Intronic
1006793477 6:36718101-36718123 CAGCAGCTGCAGGCTGAGGTGGG + Exonic
1006941802 6:37756552-37756574 CCGCAGCTGCAGGGTGAGTTGGG - Intergenic
1007073907 6:39054765-39054787 CAGCAGCTGCTGGGGGTGGAGGG - Intronic
1007180558 6:39926436-39926458 GAGCAGCGGCAGGCTGTGGAAGG + Intronic
1007290548 6:40782909-40782931 GAGGATCAGCAGGGAGAGGAGGG - Intergenic
1007323610 6:41043941-41043963 CAGCAGCAGCAGGTGCAGCAGGG - Exonic
1007342578 6:41200976-41200998 CAGCAGCAGCAGCAGCAGGAAGG + Exonic
1008052698 6:46916009-46916031 CAGCTGCAGGATGATGAGGATGG - Intronic
1008085151 6:47236597-47236619 AAGCAGCAGCAGGGTGTGGGTGG - Intronic
1008705775 6:54157353-54157375 CTGCAGGAGCAGAGTGAAGAGGG - Intronic
1009398727 6:63230213-63230235 CAGGAGCAGCAGGGTGAGCCCGG + Intergenic
1010720651 6:79279739-79279761 CAGGAGCTGCAGGTTGAGGCCGG + Intergenic
1010813685 6:80329615-80329637 CAGCACCAGCACAGGGAGGAGGG - Intronic
1011016593 6:82763228-82763250 CAGGAGCAGTAGGTGGAGGAAGG + Intergenic
1011290482 6:85772062-85772084 CAGCAGCAGCAGTGGCAGCACGG + Intergenic
1012228963 6:96737737-96737759 CAGCAGCAGCAGGGCTAGAGGGG + Intergenic
1012951326 6:105521181-105521203 CTCCAGCAGCAGGCTAAGGATGG + Intergenic
1013393689 6:109713284-109713306 CAGCAGCAGCAGAGGCAGCATGG + Intronic
1013501041 6:110751601-110751623 CAGACCCAGCAGGGTGGGGATGG - Intronic
1014011627 6:116482656-116482678 TAGCAGCAGATGGGTGAAGAAGG + Intergenic
1014701933 6:124699615-124699637 CAGCAGCAAGAGAGTGGGGAAGG - Intronic
1015227080 6:130869922-130869944 CAGCAGCAGCAGTGAGAGTGAGG - Exonic
1015320392 6:131866421-131866443 CAGCAACAGCAGAGGAAGGAAGG + Intronic
1015519124 6:134114122-134114144 ATGCTGCAGCAGAGTGAGGAGGG - Intergenic
1016870339 6:148809896-148809918 CAGCAGAATTGGGGTGAGGATGG - Intronic
1016986158 6:149897542-149897564 CAGCTGGGGCAGGGAGAGGACGG - Intronic
1017269712 6:152491838-152491860 GAGGAGCAGCCTGGTGAGGAGGG - Intronic
1017384049 6:153861936-153861958 TGGCAGCAGCAGGCTGAGCATGG - Intergenic
1018077495 6:160230120-160230142 AAGGAGCAGCCTGGTGAGGAGGG - Intronic
1018612709 6:165660945-165660967 GAGGGGGAGCAGGGTGAGGACGG - Intronic
1018915681 6:168131069-168131091 CAGCAGCAGCACGGTGCTGGAGG + Intergenic
1018988890 6:168658531-168658553 CTGTAGCACCAGGCTGAGGAGGG - Intronic
1019057277 6:169232574-169232596 CAGCAGGAGGAAGGAGAGGAAGG - Intronic
1019077885 6:169405072-169405094 CAGCAGCTGCAATCTGAGGAGGG - Intergenic
1019147412 6:169984203-169984225 GAGCAGCTCCAGGGTGACGAGGG + Intergenic
1019218292 6:170457515-170457537 CAGCAGCTGCTGGGTGTGGAGGG - Intergenic
1019274816 7:170710-170732 GAGCAGCATCAGCGAGAGGAAGG - Intergenic
1019524382 7:1474165-1474187 CACCAGCAGCAGGCGGATGAAGG + Exonic
1019631510 7:2052151-2052173 GAGCAGGAGCAGGGTGACCACGG + Intronic
1019653119 7:2171490-2171512 CAGCAGCCGGAGGGTGGAGATGG + Intronic
1019653135 7:2171572-2171594 CAGCAGCTGGAGGGTGGAGATGG + Intronic
1019653151 7:2171641-2171663 CAGCAGCTGGAGGGTGGAGATGG + Intronic
1019653161 7:2171709-2171731 CAGCAGCTGGAGGGTGGAGATGG + Intronic
1019729545 7:2622670-2622692 CAGGAGGAGCAGGGGGAGGTGGG - Intergenic
1019729556 7:2622695-2622717 CAGGAGGAGCAGGGGGAGGTGGG - Intergenic
1019751986 7:2736550-2736572 CAGCAGCAGCAGGTTGATATGGG + Intronic
1020252951 7:6483992-6484014 CTTCAGCAGCAGGATGACGATGG + Exonic
1020660457 7:10974665-10974687 GTGCAGAAGCAGGGTGGGGAGGG - Intronic
1020794108 7:12661221-12661243 CAGGAGCAGCCTGGGGAGGAGGG - Intergenic
1021040290 7:15853688-15853710 CAGCAGCAGTAAGGAAAGGAAGG + Intergenic
1021444684 7:20719660-20719682 GAGCCAGAGCAGGGTGAGGAGGG + Intronic
1022171705 7:27837792-27837814 CAGCAGCAGCAGATGCAGGAAGG + Intronic
1022342908 7:29485818-29485840 CAGAAGCAGCAGGCTGAGTGGGG - Intronic
1022460333 7:30599107-30599129 CAGCATTTGCAGGGTCAGGAAGG - Intronic
1022471784 7:30686059-30686081 ATGAAGCAGGAGGGTGAGGATGG - Intronic
1022531123 7:31067509-31067531 CAGCAGCTGGAGGGTGGGGGTGG + Intronic
1023029411 7:36079496-36079518 CAGCAGGTGCAGGCTGTGGAAGG + Intronic
1023134979 7:37042379-37042401 CAGCAGCAGTAGGGTTAATATGG - Intronic
1023255399 7:38307806-38307828 AAGCTGCACCAGGATGAGGAAGG + Intergenic
1023521113 7:41050832-41050854 CATCAGGACCACGGTGAGGATGG - Intergenic
1023714024 7:43024880-43024902 CAGCAGCAACACAGTGAGTAGGG - Intergenic
1023831293 7:44040238-44040260 CAACAGGAGCAGGGTGCGGCTGG + Intergenic
1023835712 7:44066086-44066108 CAGCAGCAGCAGAATGGGCAAGG + Intronic
1023968527 7:44975943-44975965 CAGCTGCAGCCTGGGGAGGAGGG + Intronic
1024598876 7:50962420-50962442 CAGCACCCAGAGGGTGAGGAGGG + Intergenic
1025206169 7:56994430-56994452 CAGCAGGGGCAGGGAGAGGGAGG + Intergenic
1025641614 7:63378011-63378033 CAGCAGCAGTATGGTCTGGATGG - Intergenic
1025970032 7:66314399-66314421 CAGCTGCAGGAGGCTGAGGTGGG + Intronic
1026487613 7:70834990-70835012 CAGGAGCAGGAGAGTGAGGGGGG + Intergenic
1026906026 7:74063239-74063261 CAGGAGGGGCAGGGTGGGGAGGG + Intronic
1026946746 7:74321049-74321071 CAGCAGGAGCAGGGCTAGGAGGG - Intronic
1027511958 7:79094141-79094163 AAGCAGCAGCAGGGTTTGAAAGG - Intronic
1028888132 7:95957441-95957463 CAGCAGCAGGAGGAGGAGGAGGG - Intronic
1028915302 7:96252490-96252512 CAGAAGCAGCAGGGAGGAGAGGG + Intronic
1029399682 7:100336098-100336120 CGCCAGCAGCAGGGTCAGAAGGG + Intronic
1029459019 7:100684936-100684958 CAGCAACATCAGGATGGGGATGG + Intronic
1029741623 7:102494544-102494566 CAACAGGAGCAGGGTGCGGCTGG + Exonic
1029759614 7:102593713-102593735 CAACAGGAGCAGGGTGCGGCTGG + Exonic
1029776980 7:102689623-102689645 CAACAGGAGCAGGGTGCGGCTGG + Intergenic
1030160360 7:106502159-106502181 CTGCAGAAGCAGAGTCAGGAGGG - Intergenic
1031041856 7:116846805-116846827 GGGCAGCAGCAGGGCCAGGAAGG + Intronic
1031053792 7:116972137-116972159 GAGCAGCAGCAGGGTGGGACTGG + Intronic
1031074354 7:117198706-117198728 CAGGTGCAACAGGGAGAGGAAGG - Intronic
1031597942 7:123669391-123669413 CAGCAGAAGCAGGTTTGGGAGGG + Intergenic
1031868051 7:127061610-127061632 AAGCATCAGCAGGGGGAGGAAGG - Intronic
1032364308 7:131285061-131285083 CAGAAGCTGCAGGGTGAGGATGG + Intronic
1032553170 7:132804893-132804915 CGGGAGCAGCAGTGGGAGGAGGG + Intronic
1032943513 7:136823426-136823448 CACCAGCAGCAAGGTGATGATGG - Intergenic
1033235650 7:139635915-139635937 CAGCAGCTGCTGGGAGACGAAGG - Intronic
1033623791 7:143088442-143088464 GAGCTGAAGCAGGGTGAGGCAGG + Intergenic
1033890435 7:146006407-146006429 GAGAAGGAGCAGGGGGAGGATGG - Intergenic
1034281140 7:149855372-149855394 CAGCCGCAGCAGGTTGAGGAGGG - Intronic
1034307449 7:150056657-150056679 CAGCTGCAGCGGGATGAGGTGGG + Intergenic
1034427692 7:151023300-151023322 CAGCAGGGGCAGGGTCAGGGAGG - Intronic
1034799397 7:154044035-154044057 CAGCTGCAGCGGGATGAGGTGGG - Intronic
1034889519 7:154827677-154827699 CAGCCCAAGCAGAGTGAGGAGGG + Intronic
1034950047 7:155290880-155290902 CAGGAGAAGCCGTGTGAGGACGG - Intergenic
1034970026 7:155413089-155413111 CTCCAGCAGCAGGGTGAGGAAGG + Intergenic
1035047458 7:155978043-155978065 CAGCAGCAGCAGCCTGATGTGGG - Intergenic
1035127487 7:156619025-156619047 CAGCAGCAGCTGGGGAAGGAAGG + Intergenic
1035476744 7:159149268-159149290 CAGAAGCAGAAGGGAGAGGCTGG - Intergenic
1036091275 8:5668396-5668418 CACCGGGAGAAGGGTGAGGAGGG - Intergenic
1036223053 8:6936927-6936949 CAGGAGCAGCTGTGTGGGGAGGG + Intronic
1036228288 8:6978662-6978684 CAGGAGCAGCTGTGTGGGGAGGG + Intronic
1036230741 8:6997779-6997801 CAGGAGCAGCTGTGTGGGGAGGG + Intronic
1036233187 8:7016878-7016900 CAGGAGCAGCTGTGTGGGGAGGG + Intronic
1036757499 8:11480995-11481017 CAGGAGCAGGAGGGTGTGGCTGG - Intergenic
1037143057 8:15540507-15540529 CAGCAGCAGCAGGAGAAGGAAGG - Exonic
1037841974 8:22251267-22251289 CATCAGGCCCAGGGTGAGGACGG - Exonic
1038463167 8:27733858-27733880 CAGATGCAGCAGCGGGAGGAAGG + Exonic
1039424106 8:37471472-37471494 CGTCAGCAGCAGGCTGAGGCTGG + Intergenic
1039879397 8:41615105-41615127 CAGCAGGAGGAGGTAGAGGAAGG + Intronic
1040072226 8:43197875-43197897 CAGGACCAGCAGGATGAAGAAGG - Exonic
1040377182 8:46837608-46837630 GAGCAGTATAAGGGTGAGGATGG + Intergenic
1040391578 8:46954948-46954970 CTGCAGGAGGAGGGTGAGGCCGG + Intergenic
1040548377 8:48419777-48419799 CAGCAGCAGGAGGGTGCCCATGG - Intergenic
1040639786 8:49320140-49320162 GAGAAGGAGCAGGGAGAGGAGGG + Intergenic
1040827983 8:51644792-51644814 TAGCAGCAGCAGCGTGAAGGGGG + Intronic
1041252256 8:55945936-55945958 CAGCGGCAGCAGGATGGAGACGG - Intronic
1042226880 8:66521144-66521166 GGGCAGCAGCAGGGTGAGGGTGG + Intergenic
1042874376 8:73427276-73427298 CGGCAGCAGCAGTGGGAGGAGGG + Intronic
1042939735 8:74095671-74095693 CAGCAGCAGAAGAGGTAGGAGGG - Intergenic
1043480514 8:80647804-80647826 CAGAAGCAGCAGGGTCGGGGAGG + Intronic
1045130034 8:99140678-99140700 GAGGAGGAGGAGGGTGAGGAAGG - Intronic
1045245383 8:100437727-100437749 CAGCAGCAGCAAGGCCAGGAAGG + Intergenic
1045718319 8:105074905-105074927 CAGCAGCAGCAGCGGGAGGGAGG - Intronic
1046129880 8:109954225-109954247 GAGCAGTGGCAGGGTGAGGTGGG + Intergenic
1046883890 8:119341124-119341146 CAGCAGCATCATGGTGATGTGGG - Intergenic
1047285600 8:123484865-123484887 AAGCAGCAGCAAGGGGAGGTGGG + Intergenic
1048006328 8:130422217-130422239 CAACAGCTGCAGGTGGAGGAAGG + Intronic
1048216940 8:132504871-132504893 CAGCAGCAGCCCTGTGAGGAAGG - Intergenic
1048574060 8:135677425-135677447 CAGAAGCAGCAGGGAAGGGAGGG + Intergenic
1048967606 8:139625689-139625711 CAGCTGCAGCAGAGAGATGAAGG - Intronic
1049045625 8:140149219-140149241 CAACAGCAGCATGGTCAGCACGG + Intronic
1049057979 8:140254177-140254199 CTGCAGGAGCAGAGTCAGGAGGG - Intronic
1049387306 8:142349832-142349854 CATGAGCAGCAGGGTGGGCAGGG + Intronic
1049421405 8:142518193-142518215 CAGCATGAGCAGGGTGAGAGAGG - Exonic
1049471250 8:142775928-142775950 CACCAGGATCAGGGTGAGCAGGG + Exonic
1049494274 8:142922459-142922481 CAGCATCAGCAGGGAGGGGCAGG - Intergenic
1049507952 8:143013827-143013849 CAGCGGCAGCAGGGGCTGGATGG + Intergenic
1049586583 8:143435262-143435284 CAGCAGGAGCAGGGTGGGGGTGG - Intergenic
1049586610 8:143435367-143435389 GAGCAGCGACAGGCTGAGGAGGG - Intergenic
1049586620 8:143435411-143435433 GAGCAGCGACAGGCTGAGGAGGG - Intergenic
1049689328 8:143951871-143951893 CGGCAGCAGCGGGGCGGGGAGGG - Intronic
1049718635 8:144105354-144105376 CAGCAGCCCCAGGGTGAGCAGGG + Intronic
1049719389 8:144108602-144108624 CAGCCACAGCAGGCTGAGGTTGG - Exonic
1049820314 8:144629452-144629474 GAGCTGCAGCAGGCTGGGGAAGG + Intergenic
1049846252 8:144803258-144803280 CAGCATCAGGAGAGGGAGGATGG - Intronic
1050684665 9:8154233-8154255 CAGCAAAAGCATGGCGAGGAAGG - Intergenic
1051704211 9:19859748-19859770 CAGTGGCAGCATTGTGAGGAGGG + Intergenic
1052323911 9:27196726-27196748 CAGGAGCAGAAGAGTGAGGGGGG + Intronic
1052968766 9:34363622-34363644 GAGCAGCAGCAGGGGGAAGGGGG - Intergenic
1053016012 9:34662595-34662617 CAGCAGCAGGAGGCTGCAGAAGG + Exonic
1053350906 9:37412653-37412675 CAGCTACCGCAGGGTGAGGTTGG - Intergenic
1053569322 9:39288023-39288045 AAGCAGCAGCACCTTGAGGACGG + Exonic
1053835279 9:42129053-42129075 AAGCAGCAGCACCTTGAGGACGG + Exonic
1054090954 9:60847007-60847029 AAGCAGCAGCACCTTGAGGACGG + Intergenic
1054112365 9:61122563-61122585 AAGCAGCAGCACCTTGAGGACGG + Intergenic
1054127820 9:61330987-61331009 AAGCAGCAGCACCTTGAGGACGG - Intergenic
1054595345 9:67059578-67059600 AAGCAGCAGCACCTTGAGGACGG - Intergenic
1054793559 9:69277853-69277875 CAGCAGTTGCAGTGAGAGGAAGG - Intergenic
1054820868 9:69519191-69519213 AACCAGCAGCAGGGTGGGGTGGG + Intronic
1054965984 9:71026932-71026954 CAGCAGCAGCAGGGTGCTGTAGG - Intronic
1056336102 9:85570837-85570859 GAGCCTAAGCAGGGTGAGGAAGG + Intronic
1056383071 9:86073375-86073397 CACGAGCAGCCAGGTGAGGACGG + Intronic
1056456533 9:86766163-86766185 CAGCAGCAGCTGCAGGAGGAGGG + Intergenic
1056515167 9:87343197-87343219 AAGCAGCCACAGGGTGGGGAAGG + Intergenic
1056789915 9:89618593-89618615 CAGGAGAAGCGGTGTGAGGAGGG - Intergenic
1057115258 9:92514840-92514862 GAGGAGGAGGAGGGTGAGGAGGG - Exonic
1057241044 9:93409556-93409578 CAGCAGGAGGAAAGTGAGGATGG - Intergenic
1057353903 9:94320278-94320300 GAGCAGCCGCAGGAAGAGGACGG - Exonic
1057641959 9:96833062-96833084 CAGCAGCAGAAGAGAGAAGACGG - Intronic
1057653847 9:96937312-96937334 GAGCAGCCGCAGGAAGAGGACGG + Exonic
1057906490 9:98987408-98987430 CAGCAGCCGCAGCCTGGGGAGGG + Intronic
1059150254 9:111943062-111943084 GAGCAGAAGAAGGGTGAGGCTGG - Intergenic
1059438079 9:114288452-114288474 CAGGGGGAGCAGGGCGAGGACGG + Exonic
1059740133 9:117141977-117141999 AAGCAGGATCAGGGTGAGGTTGG + Intronic
1059852919 9:118363971-118363993 AAGCAGCAGCGGGGTCAGGTAGG + Intergenic
1059915317 9:119093278-119093300 CTGCAGCAGCACTGTGGGGATGG + Intergenic
1059999210 9:119943267-119943289 CTGCAGCTGAAAGGTGAGGATGG + Intergenic
1060239160 9:121888097-121888119 CAGCAGCAGTCTGGTGAGGAAGG - Intronic
1060772717 9:126344565-126344587 CAGCAGCTGCCAGGTGAGCAGGG - Intronic
1060970883 9:127737192-127737214 CAGCAGCAGCAGAGTGGGAAAGG - Intergenic
1060989402 9:127839457-127839479 AAGAAGCAGCAGGAGGAGGAAGG + Intronic
1061120221 9:128637308-128637330 CTGCAGCAGGAAGGTGGGGATGG + Intronic
1061320320 9:129824047-129824069 CAGCAGCAGCAGGCCCAGCACGG + Exonic
1061483055 9:130906596-130906618 CAGCAGCAGGAGAGTCAGGGAGG - Intronic
1061613236 9:131762529-131762551 CCGCAGCGCCGGGGTGAGGAGGG + Intergenic
1061816339 9:133199690-133199712 CAGCTGCAGCTGGGAGAGGAAGG - Intergenic
1061958523 9:133976266-133976288 CTGCAGCAGCTAGGTTAGGATGG + Intronic
1062137833 9:134939021-134939043 CAGCAGCAGAGGGGTGGGGGTGG - Intergenic
1062285256 9:135770019-135770041 GTGCACCAGCAGGGTGATGAGGG - Exonic
1062347494 9:136122102-136122124 CAGCAGCAGCAGGGTTAGCCCGG - Intergenic
1062525690 9:136977247-136977269 CAGCAGGAGGAGGGTGGGCAAGG + Intergenic
1062572804 9:137193390-137193412 GAGGGGCAGCAGGGTGAGGAAGG - Intronic
1203780105 EBV:96266-96288 CAGGAGCAGGAGGGGCAGGAGGG + Intergenic
1203780152 EBV:96395-96417 CAGGAGCAGGAGGGGCAGGAGGG + Intergenic
1203780161 EBV:96419-96441 CAGGAGCAGGAGGGGCAGGAGGG + Intergenic
1203780170 EBV:96443-96465 CAGGAGCAGGAGGGGCAGGAGGG + Intergenic
1203780199 EBV:96521-96543 CAGGAGCAGGAGGGGCAGGAGGG + Intergenic
1203780208 EBV:96545-96567 CAGGAGCAGGAGGGGCAGGAGGG + Intergenic
1203780217 EBV:96569-96591 CAGGAGCAGGAGGGGCAGGAGGG + Intergenic
1203492339 Un_GL000224v1:118981-119003 CTGCAGGAGCTGGGTGGGGAAGG + Intergenic
1203504962 Un_KI270741v1:60853-60875 CTGCAGGAGCTGGGTGGGGAAGG + Intergenic
1185449555 X:275213-275235 GAGAAGGAGCAGGGGGAGGAAGG + Intergenic
1185480223 X:440743-440765 CAGCAGCAGCAGCCTGAGGAAGG - Intergenic
1185713026 X:2319245-2319267 CTGCAGGAGTAGGGAGAGGAGGG - Intronic
1185927538 X:4163927-4163949 CAGAGGCTGAAGGGTGAGGAGGG + Intergenic
1186584761 X:10861064-10861086 CAGAGGCAGCAGTATGAGGATGG - Intergenic
1186855707 X:13624164-13624186 CAGCAGCAGGAGAGTGAATATGG - Intronic
1187110748 X:16297187-16297209 AAGCAGCAGCAGGGTTTGAAAGG - Intergenic
1187114413 X:16334463-16334485 CAGGAGCAACAGAGTGAGGCAGG + Intergenic
1188006369 X:25018133-25018155 CAGCTGCACAAGGGGGAGGAGGG - Intergenic
1188168846 X:26895618-26895640 CAGCAAAAGCAGTGTGAAGAGGG + Intergenic
1188314824 X:28660065-28660087 AAGCAGAAGCAGAGTGAGGATGG + Intronic
1189222989 X:39388652-39388674 CAGCACCAGGAAGTTGAGGATGG + Intergenic
1189592866 X:42534140-42534162 CAGTAGGATCAGGGTGAGGCAGG + Intergenic
1190136554 X:47804360-47804382 CAGCAAAATCAGGGTGAGGTGGG - Intergenic
1190221812 X:48516747-48516769 GAGCAGAGGTAGGGTGAGGAGGG + Intronic
1190264575 X:48820197-48820219 CATCAGCAGGTGGGTGAGGTGGG - Exonic
1191103890 X:56760343-56760365 CAGCAAAAGGAGGGAGAGGAAGG - Intergenic
1191724069 X:64260308-64260330 CAGGAGCAGGAGAGTGAAGAGGG - Intergenic
1192034134 X:67545408-67545430 CAGCAGCAGCAGGGTGAGGATGG + Exonic
1192169353 X:68844673-68844695 CGGCAGCAGATGGGTGAGGAGGG - Intergenic
1193736214 X:85159838-85159860 CAGCAGCAGCAGTGGCAGCATGG - Intergenic
1193894684 X:87098673-87098695 CAGCAGCAGCAGTGGCAGTATGG + Intergenic
1193970044 X:88039611-88039633 CAGCAGCAGCAGTGGTGGGAAGG - Intergenic
1194375302 X:93125335-93125357 CAGAAGCAGAAGGGGGAGCAGGG - Intergenic
1194938328 X:99978916-99978938 CAGCATGAACAGGGTGAAGAGGG - Intergenic
1195372231 X:104188156-104188178 CAGCAGCAGCAGTGCCAGCATGG + Exonic
1195544491 X:106100104-106100126 CAGCAGCAGCAGTGGCAGTATGG + Intergenic
1196192698 X:112811191-112811213 AAGCAGCTGCAGGGTGGTGAAGG - Intronic
1196708884 X:118742169-118742191 CAGCAGGACAAGGGAGAGGAAGG - Intronic
1197358348 X:125466029-125466051 AAGCAGCAGCAGGGTTTGGGAGG - Intergenic
1197441984 X:126502737-126502759 AAGCAGTAGCAGGTTGAGGATGG + Intergenic
1197499625 X:127228221-127228243 AAGGAGCAGCATGGGGAGGAGGG - Intergenic
1197773597 X:130106202-130106224 CAGCAGCAGCTGGAGGAGGGAGG - Intronic
1198510030 X:137341135-137341157 CTGAAGCAGCCCGGTGAGGAGGG - Intergenic
1199270025 X:145872577-145872599 CAGCAGTAGCAGGGGGAGCCTGG + Intergenic
1200006872 X:153091817-153091839 CAGAAGCAGATGGGTTAGGACGG - Intergenic
1200088550 X:153623757-153623779 CAGCAGCAGGTGGGTGCTGACGG - Intergenic
1200091523 X:153638327-153638349 CAGCAGCCTGAGGGTGGGGATGG + Intergenic
1200894921 Y:8365098-8365120 GAGCAGCATAAGGGTGAGGATGG - Intergenic
1201300219 Y:12498670-12498692 AAGCAGCAGCAGGAGGAGGAGGG - Intergenic
1201363135 Y:13175182-13175204 CAGAAGCATCAGGGTGACAATGG - Intergenic
1201739734 Y:17311109-17311131 CAGCAGCAGGAGGAGGAGGAGGG - Intergenic