ID: 1192036645

View in Genome Browser
Species Human (GRCh38)
Location X:67569876-67569898
Sequence CACATGGAGATGGGGACAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 314
Summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 291}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192036645 Original CRISPR CACATGGAGATGGGGACAAT AGG (reversed) Intronic
902821857 1:18948384-18948406 CACGTGGGAATGGGGACAGTGGG - Intronic
903320900 1:22542667-22542689 GACAGGGAGTTGGGGTCAATGGG - Intergenic
904378966 1:30098555-30098577 CATTTGGAGATGGGGACTTTGGG - Intergenic
904630411 1:31837787-31837809 CACAGGGAGCTGGGGAGAACTGG - Intergenic
904804187 1:33119407-33119429 CCCATGGGGATGGAGACCATGGG + Intronic
905460678 1:38120877-38120899 CTTATGGAGAAGGGGACACTTGG - Intergenic
905712148 1:40114572-40114594 GACATAAAGATGGGAACAATGGG + Intergenic
907247780 1:53119169-53119191 CACAGGGAGATGGAGGCAACTGG + Intronic
907584133 1:55601175-55601197 CAAATGGAGTGGGGAACAATAGG - Intergenic
909804105 1:79853168-79853190 CACATGGAAATGTGGAACATAGG + Intergenic
911163953 1:94708891-94708913 CAGATGGACATGGGGACAGAGGG - Intergenic
911665322 1:100544610-100544632 CACATTGAGAAAGAGACAATAGG - Intergenic
912234855 1:107838909-107838931 GACATAAAGATGGGAACAATAGG + Intronic
912510844 1:110189307-110189329 CAGGTGGAGATGGGGACAGTGGG - Intronic
912968271 1:114256415-114256437 TACATGGATATGAGGGCAATAGG + Intergenic
913203310 1:116513601-116513623 CACATGGAGATGGGGGGAGCTGG + Intergenic
915527827 1:156487095-156487117 CACATGGAGATGGAGAGGATGGG + Intronic
915588041 1:156855132-156855154 CTCATTGAGAAGGGGACATTTGG - Intronic
916058794 1:161085255-161085277 CAAAGGGAGATGAGAACAATGGG + Intronic
918841512 1:189546244-189546266 GATAGGGAGATGGGGAGAATGGG + Intergenic
918914437 1:190616458-190616480 CACATGACAATGGGGAAAATGGG - Intergenic
919938497 1:202270796-202270818 CCCAGGGAGATGGGGACATAGGG - Intronic
921588152 1:216973010-216973032 GACATGGAGGTGGGGAGAAGTGG - Intronic
922703673 1:227777455-227777477 CACATGGAGATCAGGACCACAGG - Intronic
922774459 1:228208360-228208382 CACATGGGGATGGAGCCACTAGG + Intronic
922855028 1:228767840-228767862 CACTTGGAGAAGGAGACAAGAGG + Intergenic
1063124010 10:3124309-3124331 CACTTGGAGGTGGGAACAGTGGG + Intronic
1063320695 10:5050126-5050148 CATATGGAGAAGGTGAGAATTGG - Intronic
1063743607 10:8854342-8854364 CTCATGGAGATGCAGCCAATAGG + Intergenic
1063999240 10:11649613-11649635 GAGATGGAGTTGGGGACACTTGG - Intergenic
1064156240 10:12905645-12905667 TACATTGAGATGGAGTCAATAGG - Intronic
1064332026 10:14402946-14402968 CACATGGAGATGGGGACAGAGGG + Intronic
1064709806 10:18111660-18111682 CAAGAGGAGATGGGGACAAAAGG + Intergenic
1064857411 10:19785366-19785388 CAAATGGTGCTGGGGATAATTGG + Intronic
1065083800 10:22154175-22154197 GACATAAAGATGGGAACAATAGG + Intergenic
1068004995 10:51382782-51382804 CACATGGAGAAGGACACAGTTGG - Intronic
1069536580 10:69257973-69257995 CAGGTGGAGATGGGGACAAAAGG + Intronic
1070825619 10:79388779-79388801 CACAGGGAGGTGGTGACATTAGG - Intronic
1073974989 10:109090343-109090365 CACATGGAGAAGAGGACAAGAGG - Intergenic
1076515009 10:131040221-131040243 CACATTGACATGGGGAGAACAGG - Intergenic
1083243014 11:61403798-61403820 CATTGGGAGATGGGGACATTGGG - Exonic
1083990367 11:66242823-66242845 CACAGGAAGAAGGGGACAGTCGG + Intronic
1084551170 11:69843064-69843086 CACATTGAGATGGGGAGACCTGG - Intergenic
1084667246 11:70583044-70583066 CACATGGAGCGGGGGACAGAGGG + Intronic
1084709806 11:70836864-70836886 TATTTGGAGATGGGGACATTGGG + Intronic
1085808516 11:79658816-79658838 CATATGGAGATGGAGACTTTAGG - Intergenic
1085888319 11:80546985-80547007 CACATGTAGATGAGAAGAATGGG - Intergenic
1086293239 11:85335750-85335772 CACATGGAGATGGGGGCGGAGGG + Intronic
1087104664 11:94397762-94397784 CATGTGGAGATGAGGACAAAAGG + Intronic
1088296448 11:108301307-108301329 CATATGAAGATGTGGACAAAAGG + Intronic
1090361707 11:126177276-126177298 TACAAGGAGATGGGGACCATTGG + Intergenic
1090814704 11:130282300-130282322 AACATGGGGATGGGAAGAATGGG - Intronic
1090856307 11:130611903-130611925 CACATGGGGATGGGGGTATTGGG + Intergenic
1091640320 12:2231083-2231105 CACATGGATATGGGAAGAAAGGG - Intronic
1092971956 12:13704606-13704628 CACTTGGAGATGGTGCCAATAGG - Intronic
1094043925 12:26146365-26146387 TACATGGAAATGGGCACAACAGG - Intronic
1096483523 12:51959638-51959660 CAAATGGTGATGGTGAAAATAGG + Intronic
1096849072 12:54424001-54424023 CACATGGAGACAGGGACTAGGGG + Intergenic
1097788605 12:63789255-63789277 CCCAAGGAGATGGGGAGAAATGG + Intronic
1098347070 12:69516681-69516703 CAGATGGAGATAAGGACAAAAGG - Intronic
1100096601 12:91046741-91046763 CTCTTGTAGATGGGGGCAATAGG + Intergenic
1102162814 12:110783078-110783100 AACTTGGAGATGGGGAGAAGTGG + Intergenic
1103973283 12:124685854-124685876 CACATGCAAATCAGGACAATTGG + Intergenic
1104173752 12:126308721-126308743 GACATAAAGATGGGAACAATAGG + Intergenic
1106031691 13:26010613-26010635 CACAGGGAGCTGTGGACAGTCGG + Intronic
1106769220 13:32945417-32945439 CCCTTGGAGATGGGGAGAAATGG + Intergenic
1107676749 13:42805723-42805745 CACATGGACATGGTGATATTTGG - Intergenic
1108013986 13:46053770-46053792 CTCCTGGAGGTGGGGACGATTGG - Exonic
1108994465 13:56710174-56710196 AACATGAATATGGGGAAAATAGG + Intergenic
1110999990 13:82165794-82165816 CACTAGGAGCTGGGGACAAGCGG - Intergenic
1111693406 13:91592937-91592959 CAGAGGGAGATGGGGACCCTGGG + Intronic
1113309242 13:109113922-109113944 CACAAGGAGATGGGCTCCATAGG + Intronic
1113475603 13:110578594-110578616 CACATGGAGATGGGGCCAGTAGG + Intergenic
1113616708 13:111685469-111685491 CACATGGCGATGGTGACGTTGGG + Intergenic
1113622238 13:111770740-111770762 CACATGGCGATGGTGACGTTGGG + Intergenic
1113666210 13:112143479-112143501 AACATGGAGATGAGGACGATTGG + Intergenic
1114497967 14:23147024-23147046 CACATGTAGATGAGGATCATTGG + Intronic
1115466654 14:33722306-33722328 CTGATGGTGATGGGGAAAATGGG - Intronic
1117191013 14:53291903-53291925 AACATAGAGATGTGGACAAAGGG + Intergenic
1117409492 14:55438430-55438452 AAAAGTGAGATGGGGACAATGGG + Intronic
1118876908 14:69793687-69793709 CCAATGGCCATGGGGACAATGGG - Intronic
1121811654 14:96896507-96896529 CACAAGGAGATGGGAAAACTGGG + Intronic
1121825188 14:97004469-97004491 CACATGGTGAAAGGGACAACAGG - Intergenic
1122522711 14:102356869-102356891 CCCAAGGAGATGGGGAGAAAGGG - Intronic
1123961357 15:25404798-25404820 CATAGGGAGTAGGGGACAATAGG - Intronic
1124247701 15:28085029-28085051 CACCAGGAGGTGGGGACCATGGG + Intronic
1125122828 15:36183058-36183080 CACATGGAGTTGTGGAAAAGTGG + Intergenic
1125421213 15:39506563-39506585 GGCATGGAGATAGGGACACTTGG + Intergenic
1125427998 15:39568847-39568869 GACATAGAGATGGCAACAATAGG - Intergenic
1127497237 15:59524640-59524662 CACCTGGGGATGGGGTCACTGGG + Intergenic
1130023122 15:80247716-80247738 CACATGGAAATGTGGACACCAGG + Intergenic
1130305238 15:82709094-82709116 CAGATGGAGATGGGGACCAGAGG + Intronic
1130388866 15:83437219-83437241 CAAAGGGGAATGGGGACAATGGG + Intergenic
1130557685 15:84934328-84934350 CACATAGAGATGGGGGCATGGGG - Intronic
1131768873 15:95712827-95712849 CACAGGGAAATGGGGAGGATGGG - Intergenic
1132037911 15:98501851-98501873 CACATAGAGAATGGAACAATGGG - Intronic
1132599706 16:768063-768085 CACATGGAGGGGGGGGCAAGTGG + Intronic
1134035531 16:11027696-11027718 CTCAAGGAGATGGGCACACTTGG + Intronic
1136098734 16:27977778-27977800 CTCATGGTGGTGGGGACAGTGGG - Intronic
1136614579 16:31389913-31389935 CAAATGGAAAAGGGGAGAATTGG + Intergenic
1137567905 16:49545036-49545058 CACATGGAGAAAGTGACACTGGG + Intronic
1138383085 16:56617230-56617252 CACAAGGAAATGGGGAATATGGG + Intergenic
1138898304 16:61237434-61237456 CACTTGGTTATGGGGAGAATTGG - Intergenic
1139968281 16:70757697-70757719 CACATTGAGATCAGGGCAATGGG - Intronic
1140775305 16:78243845-78243867 CACATAAAGAAGGGAACAATAGG - Intronic
1143444317 17:6998433-6998455 CACAGGGAGATGAGGACAAGAGG + Intronic
1146185934 17:30724262-30724284 CTAATGGAGAAGGTGACAATGGG + Intergenic
1146483794 17:33227285-33227307 CACATGGAGAAGGGGCAAAAGGG - Intronic
1147894568 17:43742112-43742134 CACATGGAGAGGGGGAGCAAGGG + Intergenic
1148470316 17:47889131-47889153 CACATGGAGCTGTGGTCAATGGG + Intergenic
1148876117 17:50688230-50688252 CACATGGGGAAGGGCACACTGGG + Intronic
1149275275 17:55026934-55026956 CACATAGAGATGGGAACCCTAGG - Intronic
1149354241 17:55823629-55823651 GACATGCAGAAGGGGACACTAGG - Intronic
1150077847 17:62208354-62208376 GACATAAAGATGGGAACAATAGG - Intergenic
1152902583 17:82951958-82951980 CACGTGGAGATGGGGAGACGTGG + Intronic
1153477016 18:5508276-5508298 CCCCTGGTGATGGGGACAAAAGG + Intronic
1154062291 18:11073225-11073247 CACAAGGAGATGGGGACCACTGG - Intronic
1155056572 18:22188982-22189004 CACAAAGAGAGGTGGACAATAGG + Intronic
1155564890 18:27123201-27123223 AGCATGGATATGGGGACCATTGG + Intronic
1156599636 18:38589953-38589975 CATTTGGAGCTTGGGACAATTGG - Intergenic
1157491877 18:48129276-48129298 AACCAGGAGATGGGGACATTGGG - Intronic
1157686567 18:49647456-49647478 CAAAGGTATATGGGGACAATAGG - Intergenic
1158529214 18:58243035-58243057 CACATGCAGCTGGGGACTGTGGG - Intronic
1161736936 19:5997205-5997227 ACCATGGAGCTGGGGACAAGCGG + Exonic
1162300854 19:9844123-9844145 CATCTGGAGATGGGGACTTTGGG - Intronic
1162390977 19:10390103-10390125 AGCATGGAGTTGGGGACAACAGG + Intergenic
1162661062 19:12169369-12169391 CACACTGAGAAGGGGACAGTAGG + Intronic
1163782354 19:19257200-19257222 CTCAGGGAGAGGGGGAGAATGGG + Exonic
1164544872 19:29152061-29152083 CACAGAGAGCTGGGGACAAGTGG - Intergenic
1165176809 19:33936371-33936393 CACCTGGAGGTGGGGACCAGGGG + Intergenic
1165367743 19:35379550-35379572 CACATGAAGATGGGGATATGCGG + Intergenic
1165740623 19:38203285-38203307 CAGAGGGAGATGGGGGCAAATGG - Intronic
927304018 2:21549561-21549583 AACATGGAGAGGGAGAAAATGGG + Intergenic
929231989 2:39569507-39569529 CACATGGTGAAAGGGACAAAGGG - Intergenic
930014320 2:46960009-46960031 CACCTGGACATGGAAACAATAGG - Intronic
930167290 2:48215351-48215373 CAAATGGGAATGGAGACAATTGG - Intergenic
930568688 2:53056665-53056687 GACATAAAGATGGGAACAATAGG + Intergenic
931761395 2:65420294-65420316 AACACGGAGGTGGGTACAATGGG - Intronic
933937293 2:87217065-87217087 CACTGGGAGATGTGGACCATTGG + Intergenic
935601482 2:104926902-104926924 CACATGGACATAGGGACATAGGG + Intergenic
935873901 2:107485551-107485573 CCCTTGGAGATGGGGCTAATGGG + Intergenic
936109611 2:109654173-109654195 GAGATTGAGATGGGGACATTTGG - Intergenic
937105451 2:119308097-119308119 CCCATGAAGTTGGGGAAAATCGG - Intronic
937112357 2:119376522-119376544 CACAGGGGAATGGGGACATTTGG - Intergenic
937265593 2:120612958-120612980 CACCTGAAGATGGGGACAGGGGG - Intergenic
940615487 2:156044067-156044089 CACATGGACATGGGGGAAGTGGG - Intergenic
940715971 2:157224134-157224156 CACAAGGAGATGCTGACACTTGG + Intergenic
941143038 2:161808597-161808619 TACATTAAGATGGGAACAATAGG - Intronic
941143317 2:161812547-161812569 GACATAAAGATGGGAACAATAGG - Intronic
941838462 2:170052677-170052699 GACAGGGAGGTGGGGAAAATGGG + Intronic
942250957 2:174047458-174047480 CATAAGGAGATGGTGACAACAGG - Intergenic
942859784 2:180595810-180595832 CACATGAGGATGGGAATAATGGG + Intergenic
942865361 2:180667122-180667144 GACATAAAGATGGGAACAATAGG + Intergenic
943917249 2:193650976-193650998 CACAAAGAAATGGGGACAAGTGG - Intergenic
944710298 2:202329414-202329436 CACATGTAGATTGGGATTATGGG + Intergenic
945175327 2:207037987-207038009 CACATGAAGATGAGGTCATTGGG + Intergenic
945355962 2:208839811-208839833 CATTTGGAGATGGGGACTTTGGG - Intronic
945723392 2:213446907-213446929 CACAGGGGAATGGGGACATTTGG + Intronic
946337475 2:219048194-219048216 CAGATGGAGGTGGTGACAAAGGG - Intergenic
946519765 2:220451777-220451799 CATGAGGAAATGGGGACAATAGG + Intergenic
947534373 2:230931728-230931750 CTCATGGGGATGGGGCTAATGGG - Intronic
1170866864 20:20165309-20165331 CACAAGGAGATGGAGAAGATGGG + Intronic
1172589398 20:36106555-36106577 CACACAGTGATGGTGACAATGGG - Intronic
1173612147 20:44377247-44377269 GACATAAAGATGGGAACAATAGG + Intronic
1173823558 20:46033225-46033247 CGGATGGAGATGGGGAGAAAGGG + Intronic
1177665968 21:24160046-24160068 CACATGTAGAGGGGAACAGTTGG - Intergenic
1178281739 21:31289237-31289259 CACATGGTGATGGGCACAGAGGG + Intronic
1178872912 21:36390954-36390976 CACCTGTAAATGGGGATAATAGG - Intronic
1179226282 21:39456013-39456035 CAAAAAGAGATGGAGACAATGGG - Intronic
1179688427 21:43066840-43066862 CACAGGGGGAGGAGGACAATGGG - Intronic
1181543765 22:23588815-23588837 CATATGGAGAAGGGGACTGTAGG + Intergenic
1181821238 22:25477273-25477295 CACATCAATATTGGGACAATAGG + Intergenic
1184106403 22:42369625-42369647 CACCTGGAGATAGGGACATGGGG + Intergenic
1184373519 22:44097631-44097653 CACCTGGTGATGGTGACAGTAGG - Intronic
1184449968 22:44576962-44576984 CTCATAGAGGTGGGGAAAATGGG + Intergenic
949151053 3:767358-767380 CACAAGGAGGTGGGGGTAATCGG + Intergenic
949576380 3:5342785-5342807 CACATGGATATGGGTAAATTTGG + Intergenic
950608177 3:14103325-14103347 GACATAAAGATGGGAACAATAGG + Intergenic
951299960 3:20984287-20984309 CAATTGGAGATGTGGAAAATGGG + Intergenic
951712613 3:25600449-25600471 TACAGGGAAATGGGGATAATAGG - Intronic
952115964 3:30181974-30181996 TACATGGAGATGAAGACAAGGGG + Intergenic
952596011 3:35018230-35018252 GTCATGGAGAATGGGACAATAGG - Intergenic
952962003 3:38598186-38598208 AAGATGGAGGTGGGGAAAATGGG + Intronic
954213690 3:49112368-49112390 CACTTGGAGATGGGGACGCTGGG + Exonic
956732691 3:72211186-72211208 GACATGGAAATTGGGACAAAAGG - Intergenic
957411443 3:79846662-79846684 CACATGGAGAGAGGGAAACTGGG + Intergenic
958587609 3:96110447-96110469 TACATGGAGATAGAGACAAAGGG - Intergenic
959677270 3:109050418-109050440 CACATGGAGAAGGGGATAAGGGG + Intronic
960125643 3:113995532-113995554 CTCAAGGAGCTGGGGAAAATAGG + Intronic
960922723 3:122764036-122764058 CAGATGGATATGGGGACAAGCGG - Intronic
964144138 3:153438430-153438452 CACAGGGTGATGGGGAAAAACGG - Intergenic
964167449 3:153725645-153725667 CTCTTGGAGATGGGGACATGCGG - Intergenic
964643497 3:158934310-158934332 CACATGGTGATAGGAAGAATGGG - Intergenic
967169766 3:186813882-186813904 CACCTGGAGGTAGGGACCATGGG + Intergenic
967386187 3:188913420-188913442 GACATAAAGATGGGAACAATAGG + Intergenic
969257979 4:6015564-6015586 CACACAGACATGGGGAGAATGGG - Intergenic
969517981 4:7659189-7659211 CACATGGAGATGGTGAAATCTGG + Intronic
969664277 4:8548132-8548154 CACATGGAGATGGGGGGCAGAGG + Intergenic
971059988 4:22957078-22957100 CTCATGGAGATGGGGCTGATTGG + Intergenic
971306566 4:25487702-25487724 GACATGGAGATGGGAAGACTGGG + Intergenic
972067886 4:34974286-34974308 CACATGGAAATGAGGACAAGTGG - Intergenic
973747065 4:53974128-53974150 GACATAAAGATGGGAACAATAGG - Intronic
975000302 4:69217651-69217673 CACATTGAAATGAGGAGAATTGG - Intergenic
975005461 4:69277555-69277577 CACATTGAAATGAGGAGAATGGG + Intergenic
975013879 4:69386542-69386564 CACATTGAAATGAGGAGAATGGG + Intronic
976152556 4:82106815-82106837 GACATAAAGATGGGGAAAATAGG - Intergenic
976258443 4:83123183-83123205 CACATGGTGAAGGGGGCAAAAGG + Intronic
977917215 4:102607579-102607601 CACTGGGAGGTGGGGACAAAAGG + Intronic
978737198 4:112097461-112097483 GACATAAAGATGGGAACAATAGG + Intergenic
979101860 4:116627243-116627265 GACATAAAGATGGGAACAATAGG - Intergenic
979197678 4:117940339-117940361 CAGAAGGAGATGGGGAGAATGGG - Intergenic
980105921 4:128588294-128588316 CACATGGAGAGAGGCACATTTGG + Intergenic
980694101 4:136333822-136333844 AACATAAAGATGGGAACAATAGG + Intergenic
981868888 4:149462399-149462421 CACATGGACAAGAGGACAGTGGG - Intergenic
982341525 4:154304105-154304127 CAGATGGAGATGGGAGCCATTGG + Intronic
983371043 4:166858255-166858277 CACAAGGAGTTTGGGAAAATAGG - Intronic
985176028 4:187202061-187202083 CACCAGGAGATGGTAACAATTGG + Intergenic
985340028 4:188941036-188941058 CCCTTGGAGATGGGGACTTTGGG + Intergenic
989088966 5:37709183-37709205 CACAAGGAGATGGAAAAAATGGG + Intronic
990232861 5:53733975-53733997 AACATGGAGATGGAGAAGATAGG - Intergenic
991515684 5:67432464-67432486 CACATGGAGGTGGGCACACCAGG - Intergenic
992523996 5:77587794-77587816 CACATGGAGATTAGGACACAAGG + Intronic
995426988 5:112035913-112035935 GACATGAAGAGGGGAACAATAGG - Intergenic
996919783 5:128754377-128754399 CACATGTAGCTGGTGGCAATGGG - Intronic
997814085 5:136999379-136999401 GCCAGGGAGAAGGGGACAATGGG - Intronic
999781440 5:154853802-154853824 GATATGGACATGGAGACAATAGG - Intronic
1002183573 5:177443608-177443630 CTCAGGGAGCTGGGGACACTGGG - Intergenic
1002848157 6:967346-967368 CACATGGAGACGGTCAAAATGGG + Intergenic
1002858423 6:1058299-1058321 TACAAGGGGTTGGGGACAATTGG - Intergenic
1003350152 6:5309014-5309036 TACTTGGAGATGGGGCCAGTGGG - Intronic
1003499159 6:6690109-6690131 CACATGGAGATGAGGTCATTAGG - Intergenic
1003826214 6:9955123-9955145 TACATAAAGATGGGAACAATAGG - Intronic
1004500310 6:16203829-16203851 GACATAAAGATGGGAACAATAGG + Intergenic
1005250942 6:23945436-23945458 CACATGGAGTTAGGGATCATTGG - Intergenic
1005851957 6:29828877-29828899 CACAAGGAGAGGAGGAAAATGGG + Intronic
1006183972 6:32170013-32170035 GACATGACTATGGGGACAATGGG + Exonic
1007160937 6:39791489-39791511 CAGAGGGAGCTGGGGAAAATAGG + Intergenic
1007777334 6:44231020-44231042 AGCAGGGAGAGGGGGACAATAGG + Intronic
1007822553 6:44571389-44571411 CACATGGAGTCGGGGACTAAAGG - Intergenic
1014114216 6:117654320-117654342 TACATGGAGATGGGGCCTTTAGG - Intergenic
1017078201 6:150639671-150639693 TACATAGTGATGGGGACCATGGG + Intronic
1017850303 6:158299514-158299536 CACAAGGGAATGGGGACATTTGG - Intronic
1018631453 6:165826326-165826348 CACAGGGACATGGGGACAGAAGG - Intronic
1021154509 7:17193730-17193752 CACATGAAGATGGGAACAATAGG + Intergenic
1021217285 7:17932669-17932691 CACATGGAGGTGGGAACAGCAGG + Intronic
1021436739 7:20626149-20626171 GGCTGGGAGATGGGGACAATGGG + Intronic
1021732318 7:23607961-23607983 CACTTGGAGAGAGGGACAAAGGG + Intronic
1021898117 7:25256805-25256827 AGCATGGAGATGAGGAGAATGGG + Intergenic
1022368592 7:29749581-29749603 CACAAGGAGGTGGGGATCATGGG - Intergenic
1022732780 7:33046208-33046230 TACATTGAGATGGGAACCATAGG - Intronic
1023386869 7:39667323-39667345 CACAGGGAGTTGGGGATAAGAGG - Intronic
1023698286 7:42869796-42869818 CAGATGGAGTTGGGGAAGATGGG - Intergenic
1024504910 7:50154221-50154243 CACAGGGGGAAGGGGAAAATGGG - Intronic
1027715281 7:81661711-81661733 GACATGAAGATGGGAACAGTGGG + Intergenic
1028260261 7:88655602-88655624 CTTACAGAGATGGGGACAATAGG - Intergenic
1029241347 7:99165400-99165422 CATATGGAGATGGGGGCAACTGG - Intergenic
1030498310 7:110327791-110327813 CACATGTAGATGGGTCCACTGGG + Intergenic
1033573897 7:142661316-142661338 CACATGGTGCTGGGGATAACTGG - Intergenic
1034075316 7:148225737-148225759 GAGATGGAGATGGCGACAAGTGG + Intronic
1035645246 8:1214043-1214065 CACATGGAGGTGAGGACAGGCGG - Intergenic
1036001705 8:4612478-4612500 CACATGGAGATGACCACAACAGG + Intronic
1036002007 8:4616364-4616386 CACATGGAGATGACCACAACAGG + Intronic
1038261285 8:25997602-25997624 CAGATGGAGATGGTTAGAATGGG - Intronic
1038686032 8:29719251-29719273 CTCATGGAGATGGTTCCAATTGG - Intergenic
1038827592 8:31021767-31021789 CATATGAAAATGGGGATAATAGG + Intronic
1038982510 8:32775351-32775373 GACATAAAGATGGGAACAATAGG - Intergenic
1039793536 8:40893845-40893867 GACATGAAGAGGGGAACAATAGG - Intronic
1041158966 8:55018041-55018063 AACAGGGACATGGGGACACTGGG + Intergenic
1042097125 8:65229013-65229035 CACATGGGGATGGGTAGATTAGG + Intergenic
1043289436 8:78579005-78579027 CAAATGGAGATGGAAACAACTGG - Intronic
1044146308 8:88719003-88719025 AACATAAAGATGGGGACACTGGG + Intergenic
1044205548 8:89488815-89488837 CACTAGGAGGTGGGGATAATTGG + Intergenic
1045550636 8:103169022-103169044 CACAGGGAGATGGGGGCAGGAGG - Intronic
1046673224 8:117080515-117080537 GACATAAAGATGGGAACAATAGG - Intronic
1048279052 8:133091281-133091303 CACATGGAGAGGGGAAGGATGGG - Intronic
1048426874 8:134331179-134331201 CACATGGAGAAGGGGTCTCTGGG + Intergenic
1048969629 8:139638183-139638205 TTCCTGGAGATGGGGACATTTGG - Intronic
1049632328 8:143665485-143665507 GACAGGCAGATGGGGACAAGGGG + Intergenic
1051118582 9:13726834-13726856 CATATGTAAATAGGGACAATAGG - Intergenic
1051403876 9:16713190-16713212 CAAATGGAAATGGGTAAAATGGG + Intronic
1051504741 9:17814550-17814572 GACACAGAGATGGGAACAATAGG + Intergenic
1051511707 9:17885919-17885941 CAGCTGGAGATGGGGCCATTAGG + Intergenic
1051907728 9:22115726-22115748 CACATGGACTTGGGGATTATTGG + Intergenic
1052386554 9:27830005-27830027 CACAGGGAGAAGGGCACACTGGG - Intergenic
1052886486 9:33653715-33653737 CACATGGTGCTGGGGATAACTGG - Intergenic
1054720201 9:68596155-68596177 CCAATGGAGATGGGGACAAGGGG + Intergenic
1055141181 9:72878831-72878853 CACATGGTGCTGGGAATAATTGG + Intergenic
1055186065 9:73455504-73455526 CACAGGAACATGGGAACAATTGG - Intergenic
1056436004 9:86576708-86576730 CACAGGCAGGAGGGGACAATGGG - Intergenic
1056553801 9:87672922-87672944 CACCTGGAGGAGGAGACAATCGG + Intronic
1057694537 9:97313876-97313898 CTCAGGGAGAAGGGGACAAATGG - Intronic
1057766066 9:97920323-97920345 CTCATGGAAATGGGGAGAAGTGG + Intronic
1057790082 9:98118968-98118990 CACGTGCAGGTGGGGACGATGGG - Exonic
1059198663 9:112394678-112394700 CACAGGGGAATGGGGACATTTGG - Intronic
1059395434 9:114031479-114031501 CGGATGGTCATGGGGACAATGGG - Intronic
1061607479 9:131722188-131722210 CACCTGGAGATGGCCACGATAGG - Intronic
1061673483 9:132202352-132202374 CAAATGGTGAGGGGGACAAGAGG + Intronic
1062443825 9:136585109-136585131 GACAGGGAGATGGGGCCAGTGGG + Intergenic
1062721083 9:138044535-138044557 GGCATGGAGATGCGGACCATTGG + Intronic
1203488550 Un_GL000224v1:82037-82059 CACATTGAGGTGGGGTTAATTGG - Intergenic
1203501171 Un_KI270741v1:23933-23955 CACATTGAGGTGGGGTTAATTGG - Intergenic
1185927528 X:4163891-4163913 GACATAAAGATGGGAACAATAGG + Intergenic
1189520746 X:41764750-41764772 CATTTGGATATGGGGAGAATTGG - Intronic
1189558067 X:42165831-42165853 CACTTGGGGTTGGGGACAAAGGG + Intergenic
1190254983 X:48755526-48755548 CACATGGAGCTGGGGGTAGTGGG - Intergenic
1191633346 X:63349661-63349683 TGCATGAAGATGGGGAAAATAGG + Exonic
1192036645 X:67569876-67569898 CACATGGAGATGGGGACAATAGG - Intronic
1194718827 X:97316854-97316876 CTCATGTAGATGGGGTAAATGGG + Intronic
1196330124 X:114462225-114462247 CACATAAACATGGGAACAATAGG - Intergenic
1198672712 X:139098692-139098714 AACACAGAGATGGGAACAATAGG + Intronic
1198812193 X:140547361-140547383 CACATGGCTATGGGCACAAAGGG - Intergenic
1199236012 X:145493492-145493514 GACATGAACATGGGAACAATGGG + Intergenic
1200023141 X:153228724-153228746 CATATGGAGATAGGGCCTATAGG + Intergenic
1200747851 Y:6918117-6918139 CACTTGGACATGGGGACCAGAGG - Intronic