ID: 1192038936

View in Genome Browser
Species Human (GRCh38)
Location X:67596581-67596603
Sequence CAGACTGAACACACTGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 7, 3: 19, 4: 211}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192038936_1192038940 28 Left 1192038936 X:67596581-67596603 CCTTCCTCAGTGTGTTCAGTCTG 0: 1
1: 0
2: 7
3: 19
4: 211
Right 1192038940 X:67596632-67596654 AAGCTAGTCAGATGTATAATTGG 0: 1
1: 0
2: 0
3: 12
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192038936 Original CRISPR CAGACTGAACACACTGAGGA AGG (reversed) Intronic
900407250 1:2498171-2498193 CAGGCTGAGAACTCTGAGGAGGG - Intronic
901933447 1:12612185-12612207 CAGGCTGCACAGAGTGAGGATGG + Intronic
902369201 1:15994728-15994750 CAGGCTGGTCACACTGCGGAGGG + Intergenic
902981506 1:20126763-20126785 CAGACTCAGCACACTGTGCAGGG + Intergenic
904147602 1:28406368-28406390 CAGACTGTTCAAACTAAGGATGG + Intronic
904806783 1:33137773-33137795 CAGAATGATGAGACTGAGGAAGG - Intergenic
904842205 1:33379659-33379681 GAGGGTGAGCACACTGAGGATGG - Intronic
904846056 1:33417494-33417516 CAGACAAAATAGACTGAGGAAGG + Intronic
904986979 1:34559494-34559516 CAGACAGAAAACACTGAAGTAGG - Intergenic
906161150 1:43650027-43650049 TAGGCTGAGCACACTGAGGTCGG + Intergenic
906490664 1:46266063-46266085 CAGCCTGGAGTCACTGAGGAAGG + Intronic
909694730 1:78454181-78454203 AACACTGATCACACTGGGGAGGG - Intronic
910518534 1:88089915-88089937 CAGACTGAATACACTTAGTATGG + Intergenic
910654922 1:89609818-89609840 CAGACGGGAGACACTGAGGTGGG + Intergenic
912476334 1:109938533-109938555 GAGCCTGAACTCCCTGAGGAGGG + Intergenic
913102977 1:115586567-115586589 AAGACTGAATAAACTGATGAAGG + Intergenic
915201697 1:154234648-154234670 CAGACGGAATCCAATGAGGAAGG + Exonic
917597722 1:176545955-176545977 CACACTTACCAAACTGAGGAAGG + Intronic
917622513 1:176810980-176811002 CAGATAGAAAAGACTGAGGAAGG - Intronic
920117033 1:203628583-203628605 CAGACTCCTCACACAGAGGAGGG - Intronic
920190376 1:204189997-204190019 CAGACTTATCTCCCTGAGGATGG - Intergenic
920228201 1:204453111-204453133 CAGATTAAAGAGACTGAGGAGGG - Intronic
920813012 1:209304736-209304758 CACACTGAAAACAGTGTGGAGGG + Intergenic
923446998 1:234081109-234081131 AAGACTGAAGAGACTGAAGAAGG - Intronic
923927182 1:238644981-238645003 CAAACTGAACACACAAAGGAGGG - Intergenic
924706822 1:246509027-246509049 CAGGCTAATCACACTGTGGAGGG - Intergenic
1064343418 10:14507938-14507960 AACACTGAAATCACTGAGGAAGG + Intergenic
1066457739 10:35586415-35586437 GAGCCTGAACACACGGAGGCTGG - Intergenic
1067155064 10:43774587-43774609 CACACTGAGCACAATGATGATGG + Intergenic
1068524762 10:58115913-58115935 CAGCCTGAACAGACTGAGACAGG - Intergenic
1069806123 10:71126078-71126100 CAGAGGGAAGACACTGAGAATGG - Intergenic
1070798871 10:79233275-79233297 CAGCCTGAACAGACTAAGGCAGG - Intronic
1071346901 10:84701777-84701799 AAGACTGAAGACTCTGAGAAAGG + Intergenic
1071733504 10:88272078-88272100 CACACTGACCACCTTGAGGAGGG - Intergenic
1072615282 10:97045165-97045187 CAGCCTGAACCCACTAAGGCAGG + Intronic
1074228922 10:111514521-111514543 CGGACTGAATAGACTGTGGAAGG - Intergenic
1077610767 11:3642076-3642098 CAGACTGGAGGCTCTGAGGAAGG - Exonic
1078037400 11:7821716-7821738 CATACTTGACACACAGAGGAAGG + Intergenic
1078368424 11:10725370-10725392 CCGACTAATCTCACTGAGGAAGG - Intergenic
1078457315 11:11485351-11485373 CAGATTAATCACACCGAGGAGGG - Intronic
1080184060 11:29458111-29458133 TAGACTGACCCCATTGAGGATGG + Intergenic
1080648556 11:34204707-34204729 CAGACAGGTCACACTTAGGAAGG + Intronic
1081968704 11:47184700-47184722 CAGACAGGACACACTGCAGAGGG - Intronic
1084955948 11:72691689-72691711 GAGGCTGAAGACACTGGGGATGG + Intronic
1086445594 11:86867460-86867482 TAGAGTGTACATACTGAGGAAGG + Intronic
1089973962 11:122716633-122716655 CAGACTGAAAGCTCTGAGCAAGG - Intronic
1091022944 11:132117339-132117361 CAGACTGGAAACTCTGAGCATGG + Intronic
1091675387 12:2485386-2485408 CAGAAATAACACACTGGGGATGG - Intronic
1092937598 12:13378539-13378561 CAAACTGAAGACACTGTGGAAGG - Intronic
1096000305 12:48124195-48124217 TAGAATGAAGAAACTGAGGAAGG + Intronic
1096504964 12:52086989-52087011 CAGACTGATGGCACTGAGAATGG + Intergenic
1097887853 12:64748110-64748132 CAGACAGAACAAACTGAGAACGG + Intronic
1099902835 12:88734031-88734053 CAGAGTGAACTCATAGAGGAGGG + Intergenic
1103459000 12:121089101-121089123 CAGGCTGAACAGTGTGAGGAGGG + Intergenic
1104046268 12:125165159-125165181 CAGACTGAACTCACTGACCGAGG - Intergenic
1105454701 13:20529346-20529368 CAGCCTGAACTGACTGAGAAAGG + Intergenic
1110744861 13:79040201-79040223 GAGACAGATGACACTGAGGATGG + Intergenic
1110898847 13:80794521-80794543 CATACTGAACACAGTGACGGTGG - Intergenic
1111690608 13:91558717-91558739 AAAGCAGAACACACTGAGGACGG - Intronic
1114316243 14:21512304-21512326 CAAACTGAACACACTCATGCAGG - Intergenic
1115010212 14:28537082-28537104 CACACCGCACACACTGATGAGGG + Intergenic
1115489646 14:33946714-33946736 GAGACTTAAAACACTGATGAAGG + Intronic
1116090951 14:40306630-40306652 TAGAGTGAAAAGACTGAGGAAGG + Intergenic
1116486282 14:45452885-45452907 CAGACTGTAACCACTGAGGAAGG - Intergenic
1118038484 14:61892963-61892985 CTGAGTCACCACACTGAGGAAGG - Intergenic
1118207942 14:63740642-63740664 TAGTCTGAACACACAGAGCATGG - Intergenic
1119441496 14:74631538-74631560 CAGACTGTAAACACTAAGGCAGG + Intergenic
1120913677 14:89690771-89690793 CGGACTTAGCAGACTGAGGAAGG + Intergenic
1121634865 14:95447037-95447059 CAGACTTAAAACACTGAGCTAGG + Intronic
1122252647 14:100450821-100450843 CAGATTAAGCACACTGAGGAGGG + Intronic
1123973583 15:25531533-25531555 CACTCAGAACCCACTGAGGAGGG - Intergenic
1124583936 15:30988212-30988234 CAGACAGAACACAGCCAGGATGG + Intronic
1127535934 15:59889929-59889951 CAGTCTGAACAGACTAAGAAGGG + Intergenic
1133025268 16:2986521-2986543 GAGAGTGAACACACTCGGGAAGG + Intergenic
1133901482 16:9979388-9979410 CAGTGCGAAGACACTGAGGAGGG - Intronic
1134264788 16:12683720-12683742 CAGGAAGATCACACTGAGGATGG - Intronic
1134794513 16:17022671-17022693 CACAGTGAACACACACAGGAAGG - Intergenic
1136036100 16:27541754-27541776 CAGAGTGAAGAAACTGAGGTCGG + Intronic
1136385792 16:29925403-29925425 CAGTCGGAAGAAACTGAGGAAGG + Intronic
1140135877 16:72205078-72205100 CAGCCTAGACACACTGAGGATGG - Intergenic
1141928382 16:87184278-87184300 AAGACAGAAAGCACTGAGGAAGG + Intronic
1141942485 16:87286891-87286913 CAAACTAAACACAAGGAGGAAGG + Intronic
1142622892 17:1176166-1176188 CTGTCTGAACCCACTGAGGCTGG - Intronic
1143853854 17:9834009-9834031 CAGACAGGGCACACTGGGGATGG + Intronic
1144395670 17:14840569-14840591 CAGCCTGAACAGACTAAGGAAGG + Intergenic
1145762138 17:27431090-27431112 CAGGCTGACCACACTGCGAAGGG + Intergenic
1146734351 17:35224921-35224943 CAGACAGATCAGACTGAAGAAGG - Intergenic
1147155440 17:38542400-38542422 CACACTCACCACACTGAGGAAGG - Intronic
1147537410 17:41329522-41329544 CAGGCTGACCACACTGCGGAAGG + Intergenic
1147757037 17:42775561-42775583 CAGACTGAGCAAAATGGGGAGGG + Intronic
1148438466 17:47699541-47699563 CAGTCTGCACACAGTGGGGAAGG - Intronic
1148977268 17:51540327-51540349 CAAACTGCACACACTGTGCAAGG - Intergenic
1149982723 17:61324049-61324071 CACACTGAGAACACAGAGGAAGG - Intronic
1151030264 17:70729751-70729773 CAGAATGCTCACACTGGGGATGG - Intergenic
1151093455 17:71469114-71469136 CAAACTGAATACACTGAGGCTGG - Intergenic
1151694515 17:75707341-75707363 CAGAGATAACACACAGAGGAAGG - Exonic
1152227447 17:79098955-79098977 CAGACTGGAGGCAGTGAGGACGG + Intronic
1152688112 17:81704569-81704591 CAGCCGGAACCTACTGAGGAGGG - Intronic
1156931029 18:42643656-42643678 AAGAAGGTACACACTGAGGAGGG - Intergenic
1157213505 18:45763424-45763446 GGGACAGAACTCACTGAGGAAGG - Intergenic
1158250532 18:55482464-55482486 CAGATAGCACACACTGGGGAAGG + Intronic
1158708881 18:59819217-59819239 CAGCCTGAACAAACTAAGGCGGG - Intergenic
1159248601 18:65843299-65843321 CAGATTGAACAACCTCAGGATGG + Intronic
1159667757 18:71183838-71183860 GACACAGAACACACAGAGGAGGG - Intergenic
1160845387 19:1163967-1163989 CAGACTCAGCGCCCTGAGGACGG + Intronic
1162479089 19:10918000-10918022 AAGACTGAACACGCTGGGCATGG - Intronic
1164416622 19:28051038-28051060 CAGGCTGGACCCAATGAGGATGG - Intergenic
1166103021 19:40582509-40582531 CAGACTGTACAGACCCAGGAAGG + Intronic
1166579673 19:43883726-43883748 AAGACTGAACACACAGAAGATGG + Intronic
1168260246 19:55189482-55189504 CCGACTGAGCAGAGTGAGGAAGG - Intronic
1168399743 19:56078463-56078485 CAGCCTGAACAGACTAAGCAGGG + Intergenic
925138390 2:1534917-1534939 GAGACTGCACACATTGGGGAGGG - Intronic
925322976 2:2991115-2991137 CAGAGTGACCTCACTGAGGGTGG - Intergenic
925608517 2:5683661-5683683 TAGCCTGAACACACGGAGGCTGG + Intergenic
926508122 2:13741051-13741073 CAGACTCAACACCATGTGGAAGG - Intergenic
926817194 2:16810692-16810714 TGGGCTGAACACCCTGAGGAAGG + Intergenic
926850171 2:17187938-17187960 AAGAATGAATAAACTGAGGATGG + Intergenic
927180787 2:20445571-20445593 CAGCCTGAACACAAGCAGGAAGG - Intergenic
928402717 2:30990936-30990958 CAGACGGAACACACTGGGCTAGG + Intronic
929779310 2:44947492-44947514 CAGACTCTCCACACTGAGGCAGG - Intergenic
930022596 2:47010526-47010548 CAGACTGGACCTGCTGAGGACGG - Intronic
930517611 2:52428301-52428323 CAGACAGAGCAAAGTGAGGAGGG - Intergenic
931704932 2:64939388-64939410 TAAAGTGAAAACACTGAGGATGG - Intergenic
934154389 2:89182354-89182376 CAGACTGAAGACACTGGGGAAGG - Intergenic
934212842 2:89999586-89999608 CAGACTGAAGACACTGGGGAAGG + Intergenic
935258091 2:101330469-101330491 GAGACTGACCAAGCTGAGGAGGG + Intergenic
937713884 2:125010103-125010125 CAGACTAAAGACAATGATGAAGG - Intergenic
944059532 2:195557699-195557721 CTCACTTTACACACTGAGGAAGG + Intergenic
945112031 2:206369109-206369131 CAGTCAGAGCACACTGAAGAGGG + Intergenic
945322625 2:208442960-208442982 CAGATTCAACAGACTGTGGATGG + Intronic
946242402 2:218364691-218364713 CAGACTGTCCACGCGGAGGAGGG + Exonic
1173581032 20:44146595-44146617 GAGACTGAATTCCCTGAGGATGG - Intronic
1174106400 20:48165397-48165419 CAGACTGAGTACACAGAGGGAGG + Intergenic
1180109116 21:45639756-45639778 TAGAATGAACACAGAGAGGATGG - Intergenic
1183950540 22:41350176-41350198 CAGACTGAAGTCTCTGAGGCAGG + Intronic
1183999669 22:41663839-41663861 CAGCCTGGCCACACTGCGGAAGG - Exonic
1184910022 22:47525559-47525581 CAGACTGAACACAGTGGGGATGG + Intergenic
949094762 3:73192-73214 CAGAGTGAAAACAATGGGGAGGG - Intergenic
949529112 3:4936540-4936562 GATGCTGAACACCCTGAGGATGG - Intergenic
949724441 3:7027017-7027039 CAGGCAGAACACAATGGGGAGGG - Intronic
950454794 3:13086246-13086268 CAGAATGGACAGACTGAGGAGGG + Intergenic
950655337 3:14432913-14432935 CAGCCTGGACACACAGAGGAAGG - Intronic
952919264 3:38274116-38274138 CATAGTGAACTCACTGAGCATGG - Intronic
954762934 3:52890121-52890143 AAGCCTGAACACACTGGAGAGGG - Intronic
956869996 3:73407317-73407339 CCAGCTTAACACACTGAGGATGG + Intronic
959553384 3:107689637-107689659 TATACTAAATACACTGAGGAGGG - Intronic
961443415 3:126966384-126966406 CAGACTGAGCAGACTGAGACAGG + Intergenic
962230434 3:133661359-133661381 CGAATTGAATACACTGAGGAAGG + Intronic
962431149 3:135321161-135321183 CACACTGGTCACAATGAGGAAGG + Intergenic
963841036 3:150106653-150106675 CAGAATGAACACTGTGAGGTAGG + Intergenic
965788777 3:172365034-172365056 CAGTTTCAAGACACTGAGGAAGG - Intronic
966054002 3:175659896-175659918 CAGCCTGAACAGACTGAGGCAGG - Intronic
966857755 3:184207037-184207059 AAGACTGAACAAAGTGAGAAGGG + Intronic
968923716 4:3536044-3536066 CAGACTGAACGCACAGAGGCTGG + Intergenic
969588526 4:8108368-8108390 CAGACTGAACACACAGACAATGG + Intronic
971068370 4:23061117-23061139 AAGACAAAACAGACTGAGGAAGG - Intergenic
971097396 4:23423419-23423441 CAGGCAGAAGACAGTGAGGATGG + Intergenic
974595683 4:64012226-64012248 CACATTGGACACACTGAGGGTGG - Intergenic
975384427 4:73739202-73739224 CACTGTGAACACACTGTGGAGGG - Intergenic
975800199 4:78053533-78053555 AAGACTCAACACACAGAGTAGGG + Intergenic
976768205 4:88620768-88620790 CAGGGTAAACACTCTGAGGAGGG - Intronic
977789096 4:101077021-101077043 CAGAGTGAAGACACAGAGGCAGG + Intronic
978676456 4:111325141-111325163 CACCCTGAACACACTTGGGAAGG + Intergenic
979533564 4:121794703-121794725 CAGATGGACCACACTGATGAGGG + Intergenic
981082915 4:140652890-140652912 CAGACTAAACACACTGGGCTGGG + Intronic
981816529 4:148837225-148837247 CAGAAAGAACACACTGAAGGTGG - Intergenic
983729102 4:170971528-170971550 CAGACTGCACACTCTGAGCCTGG + Intergenic
984791252 4:183617042-183617064 GAGACTGAACACACACAAGAGGG - Intergenic
985416460 4:189740813-189740835 CAGCCTGCACATGCTGAGGATGG + Intergenic
985794648 5:1953084-1953106 CAGACAGTAAACAGTGAGGAGGG - Intergenic
985937656 5:3109074-3109096 CAGAATGCACACATCGAGGATGG - Intergenic
986596646 5:9429714-9429736 CAGAATGAAAAGACTGAGCAAGG + Intronic
987354350 5:17049457-17049479 CAAACAGAAAACACTTAGGAGGG - Intergenic
987852251 5:23371229-23371251 CAGAAAGAACACAGTTAGGATGG - Intergenic
990033337 5:51289193-51289215 CAGACTGGACACAATTATGATGG - Intergenic
992172202 5:74114472-74114494 CCAACTGAAGCCACTGAGGAGGG - Intergenic
994341521 5:98634884-98634906 CAAACAGGACACATTGAGGAAGG + Intergenic
995283812 5:110364325-110364347 GAGAGATAACACACTGAGGATGG - Intronic
996716434 5:126591658-126591680 AAGACAAAGCACACTGAGGATGG + Intronic
997401487 5:133606642-133606664 CAGAGTAAACACACAGAGCAAGG + Intronic
998173045 5:139883491-139883513 CAGACAGCACCCTCTGAGGAGGG + Intronic
999413075 5:151369504-151369526 CAGACTGAACTCCCTCAGGCTGG + Intergenic
999972317 5:156877397-156877419 CAAAGTCACCACACTGAGGATGG - Intergenic
1001692638 5:173644285-173644307 GAGACTGCACAGACTAAGGAGGG - Intergenic
1003271458 6:4611385-4611407 CAGCATGAGCACACAGAGGAGGG - Intergenic
1003414086 6:5892683-5892705 TAGGCAGAGCACACTGAGGATGG + Intergenic
1008568603 6:52793279-52793301 CAGACAGAACACATGGAGGCAGG - Intronic
1008573055 6:52833281-52833303 CAGACAGAACACATGGAGGCAGG - Intronic
1011651141 6:89507557-89507579 CAGACAGAACAAACAGAGCACGG + Intronic
1015095315 6:129408642-129408664 CTGGCTGATCACCCTGAGGAAGG + Intronic
1015793209 6:136984947-136984969 CAGATTCAACCAACTGAGGATGG + Intergenic
1017358092 6:153534042-153534064 CAGATTAATCACCCTGAGGAGGG - Intergenic
1018909923 6:168096042-168096064 CACACGGAACACCGTGAGGACGG + Intergenic
1021089452 7:16465816-16465838 CAGAGTGAAAACACAGAGAAGGG + Exonic
1021807703 7:24373540-24373562 CAGACAGGACACAATGAGGACGG - Intergenic
1021866290 7:24961730-24961752 CAGTCTGAACACACTAAGACAGG + Intronic
1022687671 7:32611829-32611851 CAGAGAAAACACACTGAGGTTGG - Intergenic
1023181184 7:37485466-37485488 CTGATTGAAAACACTGGGGAAGG - Intergenic
1024767944 7:52683657-52683679 AGGTCTGAATACACTGAGGAGGG - Intergenic
1024955093 7:54910281-54910303 AAGAGTAAACACATTGAGGAAGG + Intergenic
1025300378 7:57815182-57815204 CAGGCTGAACACAACGTGGAAGG + Intergenic
1028620473 7:92821368-92821390 CAGACAGAGCACAGTGAGAATGG - Intronic
1031007292 7:116487926-116487948 CAGAATGTTCACACTGAAGAGGG + Intronic
1032743668 7:134764801-134764823 AAGACTGAAGTCACTGAGGCAGG + Intronic
1034428406 7:151027308-151027330 CAGACACAAAACACTGAGGAAGG + Intergenic
1036619087 8:10411286-10411308 CGGTGTGAACACACAGAGGACGG - Intronic
1038047554 8:23778667-23778689 CAGATTGAACCAACTGTGGATGG + Intergenic
1039265836 8:35823011-35823033 CTGAGTGGACAGACTGAGGAGGG - Intergenic
1045201074 8:99982086-99982108 CAGACTCATCACAATGAGAATGG + Exonic
1045223266 8:100219332-100219354 CAGACTGTCCACATTGAAGATGG - Intronic
1045838435 8:106551063-106551085 CAGAATGGATGCACTGAGGAAGG - Intronic
1046454459 8:114440464-114440486 CAGAGAGAAAACACTGAGAATGG + Intergenic
1047023646 8:120804475-120804497 CAAACTGAAGACACTGTGGGTGG - Intronic
1048374043 8:133806707-133806729 AAGACTGACTACACTGAGAAGGG + Intergenic
1051048296 9:12901628-12901650 GAGACTGAACATTGTGAGGAGGG - Intergenic
1053799428 9:41755066-41755088 CAGACTGAACACACAGAGGCTGG + Intergenic
1054145787 9:61559931-61559953 CAGACTGAACACACAGAGGCTGG - Intergenic
1054187837 9:61967127-61967149 CAGACTGAACACACAGAGGCTGG + Intergenic
1054465530 9:65491035-65491057 CAGACTGAATGCACAGAGGCTGG - Intergenic
1054650678 9:67621454-67621476 CAGACTGAACACACAGAGGCTGG - Intergenic
1054814609 9:69463050-69463072 CAGAATGAACACATTAGGGAGGG + Intronic
1055111382 9:72563440-72563462 CAGAATGAACACAGTGACCATGG + Intronic
1056699377 9:88889276-88889298 GAGACTGAAAACATTGAGGGAGG + Intergenic
1056762350 9:89424627-89424649 CAGGCAGGACACAGTGAGGAAGG - Intronic
1057374201 9:94503788-94503810 CAGACAGAACCCAATGAGCAAGG + Intergenic
1062536241 9:137022260-137022282 CAGGCTGAGCATCCTGAGGATGG + Intronic
1185932528 X:4219015-4219037 CAGCCAGTACACACTGATGAAGG - Intergenic
1186217732 X:7317822-7317844 CAGAGAGAACACAGTGAAGAGGG - Intronic
1186297175 X:8162824-8162846 CAGACTGACCACACAGAGCTGGG + Intergenic
1186354827 X:8779778-8779800 CAGACTGACCACACAGAGCTGGG - Intergenic
1186376972 X:9014113-9014135 CAGACTGACCACACAGAGCTGGG - Intergenic
1186501415 X:10053699-10053721 CAGATTGAAGACTCTGAGGCTGG + Intronic
1188809303 X:34633250-34633272 CAGACAGAACACAGGGATGAGGG + Intronic
1192038936 X:67596581-67596603 CAGACTGAACACACTGAGGAAGG - Intronic
1192186380 X:68949433-68949455 CATCCTGAAGCCACTGAGGAGGG - Intergenic
1193300258 X:79881056-79881078 CAGAGTGAAGAAACTGAGGGTGG + Intergenic
1196651547 X:118173228-118173250 CAGCCTGAGCACATTGAAGATGG - Intergenic
1199242603 X:145565167-145565189 CAAACTTAAAATACTGAGGAGGG + Intergenic