ID: 1192046107

View in Genome Browser
Species Human (GRCh38)
Location X:67675597-67675619
Sequence AGGAAGATTGCAGTGACTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 430
Summary {0: 1, 1: 0, 2: 20, 3: 74, 4: 335}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192046107_1192046124 30 Left 1192046107 X:67675597-67675619 CCCACAGTCACTGCAATCTTCCT 0: 1
1: 0
2: 20
3: 74
4: 335
Right 1192046124 X:67675650-67675672 TGCTGCTGGGGGCTGGGGGAGGG 0: 1
1: 6
2: 71
3: 457
4: 2591
1192046107_1192046121 25 Left 1192046107 X:67675597-67675619 CCCACAGTCACTGCAATCTTCCT 0: 1
1: 0
2: 20
3: 74
4: 335
Right 1192046121 X:67675645-67675667 GTGGTTGCTGCTGGGGGCTGGGG 0: 1
1: 1
2: 13
3: 176
4: 1252
1192046107_1192046120 24 Left 1192046107 X:67675597-67675619 CCCACAGTCACTGCAATCTTCCT 0: 1
1: 0
2: 20
3: 74
4: 335
Right 1192046120 X:67675644-67675666 TGTGGTTGCTGCTGGGGGCTGGG 0: 1
1: 0
2: 5
3: 64
4: 650
1192046107_1192046114 16 Left 1192046107 X:67675597-67675619 CCCACAGTCACTGCAATCTTCCT 0: 1
1: 0
2: 20
3: 74
4: 335
Right 1192046114 X:67675636-67675658 GAACACCATGTGGTTGCTGCTGG 0: 1
1: 0
2: 0
3: 14
4: 122
1192046107_1192046117 19 Left 1192046107 X:67675597-67675619 CCCACAGTCACTGCAATCTTCCT 0: 1
1: 0
2: 20
3: 74
4: 335
Right 1192046117 X:67675639-67675661 CACCATGTGGTTGCTGCTGGGGG 0: 1
1: 1
2: 4
3: 35
4: 311
1192046107_1192046123 29 Left 1192046107 X:67675597-67675619 CCCACAGTCACTGCAATCTTCCT 0: 1
1: 0
2: 20
3: 74
4: 335
Right 1192046123 X:67675649-67675671 TTGCTGCTGGGGGCTGGGGGAGG 0: 1
1: 1
2: 42
3: 278
4: 1766
1192046107_1192046115 17 Left 1192046107 X:67675597-67675619 CCCACAGTCACTGCAATCTTCCT 0: 1
1: 0
2: 20
3: 74
4: 335
Right 1192046115 X:67675637-67675659 AACACCATGTGGTTGCTGCTGGG 0: 1
1: 0
2: 1
3: 41
4: 202
1192046107_1192046116 18 Left 1192046107 X:67675597-67675619 CCCACAGTCACTGCAATCTTCCT 0: 1
1: 0
2: 20
3: 74
4: 335
Right 1192046116 X:67675638-67675660 ACACCATGTGGTTGCTGCTGGGG 0: 1
1: 0
2: 6
3: 73
4: 769
1192046107_1192046122 26 Left 1192046107 X:67675597-67675619 CCCACAGTCACTGCAATCTTCCT 0: 1
1: 0
2: 20
3: 74
4: 335
Right 1192046122 X:67675646-67675668 TGGTTGCTGCTGGGGGCTGGGGG 0: 1
1: 2
2: 32
3: 178
4: 1356
1192046107_1192046112 6 Left 1192046107 X:67675597-67675619 CCCACAGTCACTGCAATCTTCCT 0: 1
1: 0
2: 20
3: 74
4: 335
Right 1192046112 X:67675626-67675648 AGCCTGCTCTGAACACCATGTGG 0: 1
1: 0
2: 1
3: 15
4: 181
1192046107_1192046119 23 Left 1192046107 X:67675597-67675619 CCCACAGTCACTGCAATCTTCCT 0: 1
1: 0
2: 20
3: 74
4: 335
Right 1192046119 X:67675643-67675665 ATGTGGTTGCTGCTGGGGGCTGG 0: 1
1: 0
2: 6
3: 50
4: 480

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192046107 Original CRISPR AGGAAGATTGCAGTGACTGT GGG (reversed) Intronic
902316736 1:15625951-15625973 AGGAAGATTGCAGTGCAGGAAGG + Intronic
905097412 1:35485646-35485668 CTGAAGGTTGCAGTGCCTGTTGG - Intronic
905740222 1:40363792-40363814 AAGGAGAGTGCAGTGATTGTGGG + Intronic
906479225 1:46189322-46189344 AGGAAAATTGGGGTGACTGAGGG + Exonic
906827172 1:48993804-48993826 AGGGAGAGTGCAGTGATTGTGGG - Intronic
907342681 1:53748044-53748066 AGGAAGATTGCTCTGGCTGTAGG - Intergenic
908093020 1:60706648-60706670 AGGGAAAGTGAAGTGACTGTGGG + Intergenic
908363273 1:63390800-63390822 AGGGAGAGTGCAGTGACTATGGG - Intronic
908457648 1:64319838-64319860 AGGAAAATAGAAGTTACTGTAGG - Intergenic
909061515 1:70883992-70884014 GCGAAGATTGCAGTGAGTGGAGG + Intronic
909582462 1:77253467-77253489 AGGGAGAGTGAAGTGATTGTGGG + Intergenic
909848910 1:80434818-80434840 AGGGAGATCTCAGTGACTGGGGG - Intergenic
910470525 1:87547745-87547767 AGGGAGAGGACAGTGACTGTGGG - Intergenic
910724845 1:90327793-90327815 AGGGAGAATGCAGTGATTGTGGG + Intergenic
910728540 1:90364242-90364264 GGGAACATTGCAGTGGCTGCTGG - Intergenic
911476282 1:98377326-98377348 TGGCAGATTTCAGTGTCTGTTGG - Intergenic
911960846 1:104300915-104300937 AGGGAGGGTGCAGTGACTGAAGG + Intergenic
912018548 1:105072980-105073002 AGGAAGAGTGCAGTGACTGAGGG - Intergenic
912633375 1:111268303-111268325 AGGAAGAACACAGTGATTGTAGG - Intergenic
912873241 1:113328863-113328885 AGGGAGAATGCAGTAATTGTGGG - Intergenic
915011210 1:152687797-152687819 AGAAGGAGTTCAGTGACTGTGGG - Intergenic
915752662 1:158226761-158226783 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
916686139 1:167148732-167148754 TGGTAAATTGCAGTGACTTTTGG - Intergenic
916744401 1:167673484-167673506 AGGAAGCTCACAGTGAGTGTTGG + Intronic
917306127 1:173627467-173627489 AGGGAGAGCACAGTGACTGTGGG + Intronic
917662889 1:177195015-177195037 AGGAAGATGGCAGAACCTGTGGG + Intronic
918357892 1:183723505-183723527 AGGGAGAGTACAGTGACTGTGGG + Intronic
919067665 1:192713886-192713908 AGGGAGAATGCATTGAGTGTGGG + Intergenic
920739301 1:208565020-208565042 AGGAAGCTTGCAGTCTTTGTAGG + Intergenic
920953768 1:210598630-210598652 AGAAAGATCACAGTGACTGTGGG - Intronic
921178119 1:212610495-212610517 GTGAGGATTGCAGTTACTGTCGG + Intronic
921277566 1:213535015-213535037 AGGTAGTTTGCAGTGTCAGTAGG - Intergenic
921678670 1:218006237-218006259 AGGAAGAGTAGAGTGACTGAGGG - Intergenic
921746123 1:218742679-218742701 AGAGAGAGTGCAGTGATTGTGGG + Intergenic
922377032 1:224979326-224979348 AGGGAGAGTGCAGTGCTTGTGGG + Intronic
924255830 1:242182004-242182026 AAGAAGATTGTATAGACTGTGGG - Intronic
924310893 1:242742032-242742054 GGGAAGATAGCAGGGACTTTAGG - Intergenic
924490926 1:244536562-244536584 AGACAGAGTGCAGTGATTGTGGG - Intronic
924516319 1:244769011-244769033 AGGGAGAGCGCAGTGACTGGGGG - Intergenic
1065224174 10:23525895-23525917 AGGAAGATTGCAATGATTTTTGG + Intergenic
1065431559 10:25662055-25662077 AAGGAGAGTGTAGTGACTGTGGG - Intergenic
1067229162 10:44395003-44395025 AGGAGGGAGGCAGTGACTGTTGG - Intergenic
1068031614 10:51711712-51711734 AGGAAGCTGTCAGTGATTGTGGG + Intronic
1068828899 10:61470228-61470250 AGGAAGAATTCAGTGCCAGTTGG + Intergenic
1069507456 10:69013471-69013493 AGGAGGGTTGCAGGGACTATTGG + Intronic
1069509474 10:69030963-69030985 AGGAAGATAGCACTAAATGTAGG - Intergenic
1071115457 10:82214027-82214049 ATGAAGATGGCAGTGTCTGGAGG + Intronic
1071482479 10:86075606-86075628 AGGAACCTTGCTGTGCCTGTGGG - Intronic
1071586948 10:86832571-86832593 AGGTAGAAGGCAGTGATTGTGGG - Intronic
1071686138 10:87759650-87759672 AAGAAGATTCCAGTCACTGGGGG + Intronic
1073227844 10:101938837-101938859 AACAAGATTGCAGTGAAGGTTGG - Intronic
1073799121 10:107022101-107022123 AGGAGGATTGCAGGGGCTGAAGG + Intronic
1073827212 10:107337478-107337500 AGGGAGATCACAGTGACTGGGGG - Intergenic
1073989712 10:109248624-109248646 TTGTAGATAGCAGTGACTGTGGG - Intergenic
1074174324 10:110980816-110980838 AGGAAGTTGGAACTGACTGTTGG - Intronic
1074232949 10:111555732-111555754 AGGAAGATTCCAATGACAGAAGG + Intergenic
1075496261 10:122922166-122922188 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1077632284 11:3818828-3818850 AAAAAGAGTACAGTGACTGTGGG + Intronic
1079443280 11:20536259-20536281 AGCCAGAGTGCCGTGACTGTGGG - Intergenic
1080096879 11:28418775-28418797 AGGCAAAGTGCAGTGAATGTGGG + Intergenic
1081128161 11:39344081-39344103 TGGAGGATTGTAGGGACTGTGGG + Intergenic
1082877538 11:58003278-58003300 AGGAAGTTTGCAGAGACAATAGG - Intergenic
1083534250 11:63454029-63454051 AGGAAAATTGCAGTCAAAGTAGG - Intergenic
1084763960 11:71295401-71295423 AGGTATAATGCAGTGATTGTGGG - Intergenic
1085194851 11:74662957-74662979 AGGGAGAGTGCAGCAACTGTGGG - Intronic
1085572244 11:77569531-77569553 AGGGAGAGTGCAGTGATTATGGG - Intronic
1085980404 11:81717867-81717889 AGGAAAACTGCAGTGATTGTGGG + Intergenic
1087874549 11:103339967-103339989 AGCAAGAGTGAAGTGAGTGTGGG - Intronic
1088855107 11:113742740-113742762 ATGAATATAGGAGTGACTGTTGG - Intronic
1089262467 11:117232395-117232417 GGGAAGATTACAGGGACAGTCGG - Exonic
1090210492 11:124917566-124917588 AGGGAGAGTGCAGTCATTGTGGG - Intergenic
1092403710 12:8199990-8200012 ACCAAAAATGCAGTGACTGTTGG - Intergenic
1092497512 12:9011815-9011837 AGGAAGAGTGCTGTGATTATGGG + Intergenic
1093025266 12:14239984-14240006 AGAAAGATTGCTGTGGCTGTGGG + Intergenic
1093531900 12:20175252-20175274 AGAGAGAGTCCAGTGACTGTGGG - Intergenic
1093931626 12:24960329-24960351 AGGAAGAGCACAGTGACTGTGGG + Intergenic
1095427290 12:42090260-42090282 TGGAAGAATGCAGTGTCTTTAGG - Intronic
1095860141 12:46907802-46907824 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
1097239541 12:57565690-57565712 AGGGAGGTTGCAGTGACCCTAGG - Intronic
1099042889 12:77677703-77677725 AGCAAGCGTGCAGTGAATGTTGG + Intergenic
1099491305 12:83292060-83292082 AGGGAGAGTGTAGTGATTGTGGG + Intergenic
1099757785 12:86876891-86876913 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1100904808 12:99285756-99285778 AGGAAGAGAGCAGTAATTGTGGG + Intronic
1100909295 12:99339328-99339350 AGGAAGAATGCAGTGATTGCTGG - Intronic
1103182072 12:118921705-118921727 AGGAAAATTGCCTTGACTTTTGG + Intergenic
1103356553 12:120325821-120325843 AGGAAAATTGGAGTGCCTGCCGG - Intronic
1103996206 12:124831805-124831827 AGGAAGATCGCAGTGACGAAGGG - Intronic
1104704338 12:130932056-130932078 AGTAAAAATGCAGTGACTGCAGG - Intergenic
1105833012 13:24182418-24182440 AGGAAGCTTCCAGTCACAGTGGG + Intronic
1106776403 13:33014603-33014625 GTGAAGATTGGAGTGTCTGTTGG - Intergenic
1107060388 13:36154011-36154033 AGGCAGCTTACAGTCACTGTGGG - Intergenic
1107391478 13:39969273-39969295 AGGAATGTTGCAAAGACTGTGGG + Intergenic
1107753960 13:43599367-43599389 AGGGAGAGTGCAGTGATAGTGGG + Intronic
1107808346 13:44175547-44175569 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1109649915 13:65311151-65311173 AGGAAGAATCCAGTGAGTGATGG - Intergenic
1110665874 13:78116770-78116792 AGGGAGAATGCAGTGACTGTGGG - Intergenic
1111335459 13:86815765-86815787 AGGGAGAGTGCTGTGATTGTGGG + Intergenic
1111800077 13:92970341-92970363 AGGAAGAATTAAGTGAGTGTGGG + Intergenic
1113834287 13:113318744-113318766 AGGGAGAAGGCAGTGAGTGTGGG - Intronic
1115153178 14:30308954-30308976 AGGAAGATTGCATTTAGTATTGG - Intergenic
1117249806 14:53925562-53925584 AGGAAGATTGCAGTAACCTTTGG - Intergenic
1117384369 14:55195809-55195831 AGGGAGAGCGCAGTGACTGATGG - Intergenic
1117795546 14:59389370-59389392 AGAAAGAGTGCAGTGGTTGTGGG - Intergenic
1119670445 14:76514287-76514309 AGGGAGATTGGATTGAATGTGGG + Intergenic
1119767658 14:77200492-77200514 AGGCAGATGGCAGAGGCTGTGGG - Intronic
1119952777 14:78763001-78763023 AGGAAAATTGGAGTGAAAGTTGG + Intronic
1122014459 14:98782311-98782333 AGCAGGATTGCACTGACTGATGG + Intergenic
1125266921 15:37892268-37892290 AGGAAGAGGACAGTAACTGTTGG - Intergenic
1127020159 15:54737739-54737761 GGGAAGATTGCAGTCACCCTAGG - Intergenic
1127245033 15:57163838-57163860 AAGAAGATGGCAGAGACTGAAGG + Intronic
1128117337 15:65118157-65118179 AGGAAGATGGCAGTGGCTGTAGG - Exonic
1128643483 15:69357955-69357977 AGGGAGTTAGCTGTGACTGTAGG + Intronic
1129030751 15:72616017-72616039 AGGGAGAATGCAGCAACTGTGGG - Intergenic
1129835661 15:78703818-78703840 AGGGAGAATGCAGCAACTGTGGG - Intronic
1130511674 15:84594818-84594840 AGGGAGAATGCAGCAACTGTGGG + Intergenic
1133834304 16:9352328-9352350 AGACAGAGTGCAGTGATTGTGGG - Intergenic
1135488924 16:22890759-22890781 AGGCAGATTCCAGAGTCTGTAGG + Intronic
1136119144 16:28118805-28118827 AGGAAGTGCTCAGTGACTGTTGG - Intronic
1136679124 16:31945057-31945079 AGGGAGATTGCAGCAACTGGGGG + Intergenic
1138890836 16:61142466-61142488 AGGGAGAGTGCAGAGATTGTGGG - Intergenic
1139005041 16:62559487-62559509 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1140317274 16:73911308-73911330 AGGTAGAGTGCAGTCAATGTGGG + Intergenic
1140800084 16:78479002-78479024 AGGCATATTGCCATGACTGTAGG + Intronic
1140841149 16:78840402-78840424 AGGACTTTTGCATTGACTGTGGG - Intronic
1141485008 16:84333167-84333189 AGGAAGACTGCAGCCACTGGGGG + Intergenic
1142598349 17:1040313-1040335 AGGAAGCTTGCAGAGAACGTGGG - Intronic
1142599729 17:1047779-1047801 AAGAGGCTTGCAGTGACTGATGG + Intronic
1142919139 17:3169345-3169367 AGAGAGAATGCAGTGAGTGTGGG + Intergenic
1143682262 17:8485735-8485757 CGTAAAACTGCAGTGACTGTGGG + Intronic
1144307046 17:13978203-13978225 AGGAAGGTTACAGAGACTGGAGG + Intergenic
1145990672 17:29077623-29077645 AGGAGGATTGGATTCACTGTTGG - Exonic
1146098965 17:29960133-29960155 AGGGAGAGCACAGTGACTGTGGG - Intronic
1146827304 17:36033874-36033896 TGGCAGATTCCAGTGGCTGTAGG - Intergenic
1148344370 17:46893748-46893770 AGAAAGATTGCTGTAACTGTCGG + Intergenic
1148498954 17:48074384-48074406 AGGAAAATTACAGAGATTGTTGG + Intronic
1148874787 17:50680535-50680557 AGGCAGACTGCTGTGACAGTGGG - Intronic
1149249345 17:54750033-54750055 TGGGAGAGTGCAGTGATTGTGGG - Intergenic
1150336976 17:64337440-64337462 AGGGATAATACAGTGACTGTGGG + Intronic
1150339286 17:64353393-64353415 AGGAAGTTTTCAGTGGCTCTTGG - Intronic
1150541391 17:66103824-66103846 AGGAAGAGCACAGTGATTGTGGG + Intronic
1150625877 17:66840785-66840807 AGGAAGTTTCCTGGGACTGTCGG + Intronic
1151785839 17:76274565-76274587 AGGAAAATTCCTGTGCCTGTTGG - Intronic
1152202515 17:78955321-78955343 AGCAAGATCCCAGTGACTGAGGG + Intergenic
1153765370 18:8369556-8369578 AGGAAGAGCGCAGTGACTGTGGG + Intronic
1155767349 18:29652369-29652391 AGGGAGAATGCAGTGAATGTGGG + Intergenic
1156379823 18:36547689-36547711 AGGAACGTCGCAGTGTCTGTGGG + Intronic
1157879197 18:51304113-51304135 AAGGAGAGTGCAGTGATTGTGGG + Intergenic
1158323860 18:56293385-56293407 AGGAAGATTGCATTGTTTGATGG + Intergenic
1159285042 18:66337554-66337576 GGGAAGAGCTCAGTGACTGTGGG - Intergenic
1159872812 18:73777539-73777561 GTGAAGATTGCATTGACTGAAGG - Intergenic
1160962357 19:1728620-1728642 AGGAAGGTTGCATTGACCGGCGG + Intergenic
1161790975 19:6360045-6360067 AGGAAGATTGCTGGTAATGTTGG - Intergenic
1166486181 19:43214890-43214912 AGGAAGATTTCAAAGACTGGAGG + Intronic
1167819685 19:51915903-51915925 AGTATGACTGCAGTGACTGTGGG - Intronic
1168448961 19:56448178-56448200 AGGAAGAATGGAGTGATGGTGGG + Intronic
925011086 2:486833-486855 AGGAAGATGGCAGTTAATATGGG - Intergenic
925063865 2:914094-914116 GGGAAGCTTGCAGAGAATGTTGG + Intergenic
925064082 2:915391-915413 CGGAAGAATGCAGTGACCCTGGG - Intergenic
926449493 2:12984772-12984794 ATGTAGTTTGCAGTGCCTGTGGG - Intergenic
927170510 2:20365538-20365560 AGGAAGAATGCAGCTACTATGGG - Intergenic
927323308 2:21773548-21773570 AGTAAGGTGGCAGTGATTGTTGG - Intergenic
927720480 2:25378919-25378941 AGGAAGTGGGCAGTGGCTGTGGG + Intronic
928715648 2:34056696-34056718 AGGAAGAGTGCCATGATTGTGGG - Intergenic
928767855 2:34670003-34670025 AGAAAGAGTGTAGTGACTCTGGG + Intergenic
929281837 2:40088203-40088225 AAGGAAAGTGCAGTGACTGTGGG - Intergenic
929447219 2:42010954-42010976 AGAAAGATTGCAGTGACCTGGGG - Intergenic
930439784 2:51391220-51391242 AGGGAGAGTACAGTGACTGGGGG - Intergenic
930778157 2:55196028-55196050 AGGAAGAGTGCAGTGATTGTAGG + Intronic
933917922 2:87015081-87015103 AGGAACATGGGAATGACTGTAGG - Intronic
934005073 2:87754833-87754855 AGGAACATGGGAATGACTGTAGG + Intronic
934541786 2:95181343-95181365 ACCAGGAATGCAGTGACTGTGGG + Exonic
934745098 2:96754175-96754197 AGGAAGGCTGCAGGGACTGGTGG - Intergenic
934928862 2:98404045-98404067 GGGGAGAGTGCAGTGATTGTGGG + Intergenic
935194347 2:100803362-100803384 AGAAACATTGCAGTGATTTTCGG - Intergenic
935768034 2:106388873-106388895 AGGAACATGGGAATGACTGTAGG + Intergenic
936940504 2:117879297-117879319 AGGGAAAGTGCAGTGATTGTGGG - Intergenic
938242340 2:129753055-129753077 AGAAAAATTGCACTGTCTGTGGG - Intergenic
938291759 2:130154395-130154417 AGGAAGCTCCCAGTGAATGTGGG + Exonic
938464791 2:131518568-131518590 AGGAAGCTCCCAGTGAATGTGGG - Intergenic
938587636 2:132707207-132707229 GGGGAAAGTGCAGTGACTGTGGG + Intronic
938983775 2:136552837-136552859 GCAAAGATTGCAGTGACTTTTGG + Intergenic
939144423 2:138395703-138395725 AGAGAGACTGCAGTGACTGTGGG + Intergenic
939708027 2:145479185-145479207 AGGAAGACTGCAGTGACTAAGGG - Intergenic
940083466 2:149831572-149831594 AGGTAGATTGTATTTACTGTTGG + Intergenic
940795252 2:158070867-158070889 AGGGAGAGCACAGTGACTGTAGG + Intronic
941047642 2:160694739-160694761 AGGGAGAGTGCAGTGACTGGTGG - Intergenic
941228937 2:162884631-162884653 AGGAAGATTGCAGTGATCTGAGG + Intergenic
941640395 2:167981821-167981843 AGGATGATGGCAGTGGCTGTGGG - Intronic
941742138 2:169046599-169046621 AGGGAGAGCACAGTGACTGTGGG + Intergenic
942881796 2:180870665-180870687 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
943000574 2:182323598-182323620 TGGAAGATTTAAGTGCCTGTCGG + Intronic
943099656 2:183472223-183472245 AGGGAGAGTGCAGTGACTATGGG - Intergenic
943867047 2:192938491-192938513 AGGGAGAGTGCAGTGACTGAGGG - Intergenic
944129785 2:196335327-196335349 AGAGAAATTCCAGTGACTGTAGG - Intronic
944133379 2:196370828-196370850 AGGGAGAATGCAGTGATTGTGGG - Intronic
944616548 2:201465909-201465931 AGGGAGAGTGCAGTGATTGTGGG - Intronic
944760240 2:202807310-202807332 AGGGAGAGTGCAGTGATTGTGGG + Intronic
944855209 2:203760514-203760536 AGAAAGAGTGCAGTGATTGCAGG - Intergenic
944948002 2:204712802-204712824 AGGAAGATTACTATGACTGGAGG - Intronic
945334323 2:208573491-208573513 AGGTAGAGTGAAGTGATTGTGGG + Intronic
945748137 2:213744364-213744386 AGGAAGCTTGGGATGACTGTGGG - Intronic
947126818 2:226877849-226877871 GTGAAGAGTGCAGTGACTATTGG + Intronic
947691969 2:232146762-232146784 AGGAAGACAGAAGTGAATGTTGG + Intronic
948774555 2:240277081-240277103 AGGGAGAGAGCAGTGACTGTGGG + Intergenic
1169070063 20:2720555-2720577 AGGTAGATTGCAGTAAGTTTAGG - Intronic
1169301162 20:4443134-4443156 AGGAGGATTGGCATGACTGTAGG + Intergenic
1169932976 20:10853835-10853857 AGCAAGCGTGGAGTGACTGTGGG + Intergenic
1170311409 20:14996693-14996715 AAGGAGAGTGCAGTGATTGTAGG + Intronic
1170864221 20:20138508-20138530 AGAGAAAGTGCAGTGACTGTGGG - Intronic
1171415698 20:24979226-24979248 AGGTAGACTCCAGTGGCTGTAGG - Intronic
1172729260 20:37071865-37071887 AGGAAGTTTACAGTCACGGTAGG - Intronic
1172838890 20:37890201-37890223 AGGAACAGCGCAGTGAATGTGGG + Intergenic
1172894065 20:38287087-38287109 AGGAAGCTTGCAGGGAGTGGGGG + Intronic
1174212304 20:48889787-48889809 AAGAAGAAGGCAATGACTGTTGG - Intergenic
1174690932 20:52503813-52503835 AAGAAGAGTGTGGTGACTGTGGG + Intergenic
1174959155 20:55135442-55135464 TGGAAGATTGAAGAGGCTGTGGG + Intergenic
1175549412 20:59807351-59807373 AGGAAGATGACAGTGATTGATGG - Intronic
1175632274 20:60551207-60551229 AGAGAGAGTGCAGTGATTGTAGG - Intergenic
1176940060 21:14912637-14912659 AGGGAGAATGCATTGATTGTGGG - Intergenic
1177105068 21:16945487-16945509 AGGAAGAGTGCAGAGACCGTGGG + Intergenic
1177295141 21:19163560-19163582 AGAAAGAGTGCAGTGATTGTGGG - Intergenic
1177539734 21:22477109-22477131 AGGGAGAGTGCAGTAATTGTAGG + Intergenic
949626606 3:5874313-5874335 AGAAACATTTCAGTGGCTGTGGG - Intergenic
950801197 3:15552974-15552996 AGGGAGAGTGCCGTAACTGTGGG - Intergenic
951029399 3:17864124-17864146 AGGGAGAGCACAGTGACTGTGGG - Intronic
951279667 3:20732346-20732368 AGGGAGAGTGCAGAGATTGTGGG - Intergenic
952052862 3:29407161-29407183 AGCAAGTGTGCAGTGATTGTTGG - Intronic
952688486 3:36176245-36176267 AGGAAAAGTGCAGTGATTGTGGG - Intergenic
953461925 3:43088455-43088477 AGGAAGAGGGCAGTGGCTGCTGG - Intronic
953899494 3:46831706-46831728 AGGGAGATTGCACTGCCTGGGGG - Intronic
954086025 3:48244751-48244773 AGTAATAGTGCAGTTACTGTGGG - Intronic
955585332 3:60471512-60471534 AAGGAGAGTGCAGTGATTGTGGG - Intronic
957516460 3:81259591-81259613 AAGAAAATTGCACTGACTGTTGG + Intergenic
957965724 3:87320984-87321006 AGGGAGAGTACAGTGATTGTGGG + Intergenic
958111709 3:89156159-89156181 AGGAAGATTATAATGACTGGTGG + Intronic
958147005 3:89639277-89639299 AGAAAGAATACAGTGACTGTGGG + Intergenic
958682691 3:97352489-97352511 AGAGAGAATGCAGTGACTGTGGG + Intronic
958784565 3:98583636-98583658 GGGAGGATAGCAGTAACTGTGGG + Intronic
959191072 3:103112399-103112421 AGGGAGACTGCAGTGACTGGGGG + Intergenic
959806710 3:110562855-110562877 AAGGAGAATGCAGTGATTGTGGG - Intergenic
960247015 3:115411129-115411151 AGGAAGATGGCACTTACTTTTGG + Intergenic
961569276 3:127786477-127786499 AGGGAGAAGGCAATGACTGTGGG + Intronic
963154023 3:142077043-142077065 AGGGAGAGCTCAGTGACTGTGGG + Intronic
965264052 3:166518184-166518206 AGGGAAAGTGCAGTTACTGTGGG + Intergenic
966106796 3:176345538-176345560 AGGAATGATGCAGTCACTGTTGG + Intergenic
966141830 3:176766299-176766321 AAGAAGAGTGCAGGGATTGTGGG + Intergenic
967515869 3:190367899-190367921 ATGCAGATTGCAGAGACTTTTGG - Intronic
969762342 4:9197792-9197814 ACCAAAAATGCAGTGACTGTTGG + Intergenic
972125399 4:35758931-35758953 AGGGAGATTGCAGTGATTGTGGG - Intergenic
972253678 4:37331879-37331901 AGGGAGAGTACAGTGATTGTGGG + Intronic
973287945 4:48440428-48440450 AGGGAGAGCACAGTGACTGTGGG - Intergenic
973348443 4:49082258-49082280 AGGGAAAGTGCAGTGATTGTGGG + Intergenic
973842408 4:54875625-54875647 AGGAAGATGGCAGGGAGTGATGG + Intergenic
974102782 4:57436148-57436170 ACGATGATGGCAGTGAGTGTGGG - Intergenic
975095753 4:70454453-70454475 AGGGAGCATGCAGTGCCTGTGGG - Intronic
976684166 4:87792512-87792534 AGGTACATTACAGTGAGTGTGGG + Intergenic
977644389 4:99395645-99395667 AGGGAGAGTGCAGTGATAGTGGG + Intergenic
978387864 4:108193797-108193819 AGTAAGAATGAAGTGACTGTGGG + Intergenic
978478245 4:109157137-109157159 AGGAAGAGCACAGTGACTGAAGG + Intronic
979565189 4:122146462-122146484 AAGGAGAGTGCAGTGATTGTGGG - Intergenic
980562068 4:134490657-134490679 AGGGACATTGCAGTAACTTTGGG - Intergenic
980956505 4:139434025-139434047 AGGGAGATCGCAGTGATTGTGGG - Intergenic
981286401 4:143024183-143024205 AGGAAGAGTGTAGTGATTGTGGG + Intergenic
981996046 4:150976809-150976831 TGGGAGAGTGCAGCGACTGTGGG + Intronic
982863296 4:160481563-160481585 AGGAAGACGGCAGTGAAAGTAGG + Intergenic
982911454 4:161148057-161148079 AGGAAGAGTACATTGACTGTAGG + Intergenic
983338182 4:166422024-166422046 AGGGAGAGCACAGTGACTGTGGG - Intergenic
983657851 4:170101030-170101052 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
984493553 4:180467965-180467987 AGGTAGAATGCAGAAACTGTAGG - Intergenic
984496283 4:180501678-180501700 AGGAAGAATGCAGTGATAGTTGG - Intergenic
985420122 4:189776898-189776920 AGGAAGATGGCTGTGACTGCAGG - Intergenic
986085203 5:4437945-4437967 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
986548242 5:8923625-8923647 AGGAAGAGTGCAGGGACTGTGGG + Intergenic
986631304 5:9776246-9776268 AGGGAGAGTGCAGTGACTACAGG - Intergenic
986735039 5:10662181-10662203 AGGAACATTGCAGGGGCTGGTGG + Intergenic
986745083 5:10736720-10736742 AGGAAGATTCCCGTTGCTGTTGG - Intronic
986795396 5:11205854-11205876 AAGCACATTGCAGTGACTGGAGG + Intronic
987023576 5:13900084-13900106 AGGATGAATGGAGTGACTGAGGG - Intronic
987645777 5:20671244-20671266 AGGGAGAGTGAAGTGACTGTGGG + Intergenic
988608644 5:32704159-32704181 AGACAGAGTGCAATGACTGTGGG - Intronic
990170854 5:53048130-53048152 AGGAGGAGTGCTGAGACTGTTGG - Intronic
990663242 5:58042525-58042547 AGAAACATTGCAGTGAATATTGG + Intergenic
990827817 5:59922044-59922066 AGGGAGAGTGCAGCGACTGGGGG + Intronic
991043126 5:62195737-62195759 AGTAACATTCCAGTCACTGTTGG - Intergenic
991209249 5:64085212-64085234 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
992531913 5:77660116-77660138 AGGGAAAGTGCAGTGATTGTGGG - Intergenic
992934418 5:81687191-81687213 AGGGAGAGCACAGTGACTGTGGG + Intronic
993060168 5:83029486-83029508 GGGGAGAGTGCAGTGATTGTGGG + Intergenic
993138253 5:83997828-83997850 AGGGAGAATGAAGTGATTGTGGG + Intronic
993215619 5:85019464-85019486 AGGAAGATTGTGGTGATTGCTGG - Intergenic
993230273 5:85226568-85226590 AGGGAGAGTGAAGTGAATGTGGG - Intergenic
993279264 5:85904750-85904772 AGGGAAAGTGCAGTGACTGAGGG + Intergenic
993932315 5:93954957-93954979 AGGGAGAGCACAGTGACTGTGGG - Intronic
994217974 5:97159917-97159939 ATGAAGAGTGCAGTGACTGTGGG - Intronic
994533644 5:100999667-100999689 AGGGAGAGTGAAGTGAGTGTGGG + Intergenic
995268742 5:110195729-110195751 AGGAAGAGTGCAGTGATTGTGGG - Intergenic
995310695 5:110707348-110707370 AGGGAGAGTGCAGTAACTGCAGG + Intronic
995508663 5:112885972-112885994 TGGATGTTTACAGTGACTGTGGG + Intronic
995573286 5:113503636-113503658 AGGGAGAGTGCAGTGATAGTGGG - Intergenic
995697908 5:114900389-114900411 AGGAAGAGTGTTGTGATTGTGGG - Intergenic
996653715 5:125913992-125914014 AGGAAGAGCTCAGTGATTGTGGG - Intergenic
997437824 5:133887703-133887725 AGGGACAGTCCAGTGACTGTGGG + Intergenic
998182362 5:139954366-139954388 AGGAAGAATGAAATGACTGGAGG + Intronic
999559448 5:152785117-152785139 AGGGAGAGTGCACTGACTGTGGG + Intergenic
1001845255 5:174916445-174916467 AGGGAGAATGCAGCAACTGTGGG + Intergenic
1004022006 6:11784528-11784550 AAGAATGTTGCAATGACTGTGGG - Intronic
1005996605 6:30934997-30935019 GGGAAGATTTCAGAGACAGTAGG - Intergenic
1006611431 6:35296651-35296673 AGGAACATTGCAGGGATTGGTGG + Intergenic
1007021743 6:38528117-38528139 AGGCAGAGTGTAGTGACTGTGGG + Intronic
1007187380 6:39983845-39983867 AAGAAAATTACAGTGACTTTTGG - Intergenic
1008101147 6:47392495-47392517 AGGGAGACAACAGTGACTGTGGG - Intergenic
1008192267 6:48474838-48474860 AGGAAGAATGCAGTAACTGTGGG + Intergenic
1008238792 6:49083692-49083714 ATGAAGAGTGCAGTGATGGTGGG + Intergenic
1009039463 6:58159102-58159124 AGGCAGAATGCAGTGATTATGGG - Intergenic
1009215355 6:60913942-60913964 AGGCAGAATGCAGTGATTATGGG - Intergenic
1009461459 6:63919170-63919192 AGGAAGGTAGCAGTGAGTTTGGG + Intronic
1009781674 6:68279682-68279704 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1009978786 6:70701664-70701686 AGGGAGAACGCAGTGATTGTGGG - Intronic
1010890640 6:81306195-81306217 AAGAACATTCCAGTGACTGGTGG + Intergenic
1011970912 6:93221334-93221356 AGGGAGATGGCAGTGAGTGTAGG - Intergenic
1012073796 6:94657774-94657796 AGGGAGAAAGCAGTGACTGATGG - Intergenic
1012283509 6:97359888-97359910 AGGAAGATTTCAGTGTATATTGG - Intergenic
1013908450 6:115245936-115245958 AGGAAGAGTACAGCGATTGTGGG + Intergenic
1014275609 6:119384876-119384898 AGGAAGAGTGCAGCGACTGCGGG - Intergenic
1015578934 6:134702470-134702492 AGAGAGAGTGCAGTGACTGTGGG - Intergenic
1016012259 6:139149576-139149598 AGGGAGTTTGCAGTGAATGCCGG + Intronic
1016054843 6:139567520-139567542 AGGAAGAGCACAGTGATTGTGGG - Intergenic
1016055081 6:139570173-139570195 ATAAATATTGCAGGGACTGTGGG + Intergenic
1016086684 6:139923444-139923466 AGGGAGATAGCAGTGGCTGCAGG - Intergenic
1017471182 6:154738005-154738027 AGGAAGATGCCAGAGACTTTAGG + Intronic
1018120932 6:160634740-160634762 CTGAAGATTGCACTGACTGCTGG + Intronic
1018128878 6:160709053-160709075 AGGAACATGGGAATGACTGTAGG + Intronic
1020574935 7:9913997-9914019 AGGGAGAGTGTAGTGATTGTGGG - Intergenic
1021123629 7:16825635-16825657 AGGGAGAATGCAGTGATTATGGG + Intronic
1022809266 7:33852913-33852935 AGGAAGATTGAAGTGTCAGCAGG - Intergenic
1022827523 7:34030959-34030981 AGGAAGACTGAGGTGAATGTTGG + Intronic
1022936709 7:35185999-35186021 GGGAAGATTGCAGCGGCTTTGGG + Intergenic
1023646163 7:42318271-42318293 AGGGAGAGTGCAGTGGTTGTGGG + Intergenic
1024369222 7:48560323-48560345 AGGAAGAGCACAGTGACTGGGGG - Intronic
1024705956 7:51959785-51959807 AGGAAGAATGCAGTGACTGGGGG - Intergenic
1025061536 7:55812848-55812870 AGGGAGAGTGAAGTGATTGTGGG + Intronic
1027523955 7:79244451-79244473 AGGGAGAGTGCAGTGATTGTGGG + Intronic
1028266700 7:88734305-88734327 AGGAAGACTGTAGTGATTATGGG - Intergenic
1028299657 7:89181496-89181518 AGGGAGACTGCAGGGACCGTGGG - Intronic
1028929664 7:96398414-96398436 AGGGAGAATGCAGTGATTGTGGG - Intergenic
1028972468 7:96874792-96874814 AGAGAGAGTGCAGTGATTGTGGG + Intergenic
1029042610 7:97593395-97593417 AGGGAGAGTGCAGTGGCTGTGGG - Intergenic
1029832946 7:103280110-103280132 GGGAAGATTGCAGCGGCTTTGGG + Intergenic
1030118231 7:106080261-106080283 GGCCAGATTGCAGTGAGTGTGGG - Intergenic
1031009409 7:116509910-116509932 AGAAAGATGGCAGTGATTATGGG - Intergenic
1031412599 7:121457440-121457462 AGGGAGAATGCTGTGACTGTGGG - Intergenic
1032681530 7:134189483-134189505 AGGAAGTCTGCAGTGGCTGCAGG + Intronic
1033542474 7:142369605-142369627 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1033877773 7:145843225-145843247 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1034847914 7:154464261-154464283 AGGGAGAATGCAGTGACTGTGGG - Intronic
1035417239 7:158699966-158699988 CTGCAGAGTGCAGTGACTGTTGG + Intronic
1036225502 8:6954420-6954442 AGGAAACTTGCCTTGACTGTGGG - Intergenic
1036272430 8:7319538-7319560 ACCAAAAATGCAGTGACTGTTGG + Intergenic
1036348918 8:7990802-7990824 ACCAAAAATGCAGTGACTGTTGG - Intergenic
1036420256 8:8588838-8588860 AGTGAGATTGCATTGCCTGTGGG + Intergenic
1036844179 8:12151279-12151301 ACCAAAAATGCAGTGACTGTTGG - Intergenic
1036865553 8:12393600-12393622 ACCAAAAATGCAGTGACTGTTGG - Intergenic
1038559046 8:28553679-28553701 TGGAAGATCACAATGACTGTTGG - Intronic
1040738962 8:50548199-50548221 AGTAAGATTGGAGTGACTGGAGG + Intronic
1041754410 8:61298108-61298130 AGATAGATTGCAATGAGTGTAGG + Intronic
1041857670 8:62476945-62476967 AGGAAGAATGCTGTGACTTCAGG + Intronic
1043079972 8:75754838-75754860 AGGGAGAGTGCAGTGACTATGGG + Intergenic
1043819704 8:84847288-84847310 AGGCTGAGTGAAGTGACTGTGGG - Intronic
1044159310 8:88893392-88893414 AGGAATATAGCAGTGAATATGGG + Intergenic
1044497327 8:92902383-92902405 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1045335390 8:101198306-101198328 AGGAAGATTGGAATGACTTGTGG - Intronic
1045645496 8:104293291-104293313 AGGAAGGTGGCAGTGCCTGTAGG - Intergenic
1045826952 8:106409181-106409203 AGGAAAATAGCAGTCACAGTAGG + Intronic
1048118673 8:131554819-131554841 AGGGAGAGCACAGTGACTGTGGG + Intergenic
1048158867 8:131992799-131992821 GGGAAGGTTGAAGTTACTGTTGG + Intronic
1049587816 8:143440126-143440148 AGGCAGCTTGCAGAGCCTGTTGG + Exonic
1049900685 9:160907-160929 AGAAAAATTCCAATGACTGTTGG - Intronic
1050085226 9:1958382-1958404 AAGAAGACTGCAGTGTCTGATGG - Intergenic
1050248062 9:3713005-3713027 TGGAAGAGTGCAGTGACTGGGGG + Intergenic
1051464941 9:17367190-17367212 AGGGAGAATGCAGTGACTGTTGG + Intronic
1051501453 9:17782419-17782441 GGGAAGATTGGAGTGAATGATGG + Intronic
1052860574 9:33435516-33435538 AGGACAATTGCAGTGACTCTGGG - Intergenic
1053234651 9:36442098-36442120 AGGAAGATTGGAATGCCTGATGG - Intronic
1053743724 9:41171190-41171212 AGAAAAATTCCAATGACTGTTGG - Intronic
1054349000 9:64001007-64001029 AGAAAAATTCCAATGACTGTTGG - Intergenic
1054483547 9:65694116-65694138 AGAAAAATTCCAATGACTGTTGG + Intronic
1054684619 9:68260068-68260090 AGAAAAATTCCAATGACTGTTGG + Intronic
1055296132 9:74835583-74835605 AGTAAGATTTCAGTAAGTGTTGG + Intronic
1055717267 9:79131741-79131763 AGGAGGTTTGCAAAGACTGTAGG - Intergenic
1056516665 9:87358799-87358821 AGAGAAAGTGCAGTGACTGTGGG + Intergenic
1057549301 9:96040214-96040236 AGGAAGAGTGCAGAGGCTGGCGG - Intergenic
1057831306 9:98409300-98409322 GAGAAGATTGCACTGTCTGTGGG + Intronic
1058285363 9:103170065-103170087 AGGGAGAGGGCAGTGACTGTGGG - Intergenic
1058873953 9:109225787-109225809 AGGATGATGGCAGTGGCTGGGGG + Intronic
1059555600 9:115277131-115277153 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1060515151 9:124260928-124260950 AGGAAGGTAGCAGGCACTGTGGG + Intronic
1060756495 9:126218129-126218151 AGTTAGATTGCAGTGAGTGAAGG + Intergenic
1060909952 9:127341612-127341634 AGGAAGACAGCATTCACTGTAGG + Intronic
1187026607 X:15441807-15441829 AAGAAGATGCCTGTGACTGTAGG + Intronic
1187454494 X:19429327-19429349 AAGAAAATGGCAGTGACTGGGGG + Intronic
1187579422 X:20592506-20592528 AGGAAGAGCACAGTGACTGGAGG - Intergenic
1187713419 X:22076990-22077012 AGGAAGAAGCCAGTGCCTGTGGG + Intronic
1187871039 X:23765804-23765826 AGGAGAATTGCAGAGACCGTAGG - Intronic
1188162001 X:26815412-26815434 AGGGAGAGTGCAGTGATTGTAGG - Intergenic
1188651420 X:32635146-32635168 AGGGAGATTGCAGTGATTATAGG - Intronic
1188897346 X:35685821-35685843 AGGGAGATAGCAGTGACTGGGGG + Intergenic
1190092134 X:47448351-47448373 CGTATGAATGCAGTGACTGTGGG - Exonic
1190397005 X:49995210-49995232 AGGAAGATTTCAGGGCGTGTCGG - Intronic
1192046107 X:67675597-67675619 AGGAAGATTGCAGTGACTGTGGG - Intronic
1192793302 X:74405735-74405757 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1192875348 X:75223645-75223667 AGGGAAACTGCAGTGATTGTGGG - Intergenic
1193896935 X:87126496-87126518 AGGGAGAGTGCAGTGATTATGGG + Intergenic
1194329120 X:92559648-92559670 AGGAATATTGCAGTGACTGGGGG + Intronic
1194388930 X:93292459-93292481 AGGGAGAATGCAGTGACTGGGGG + Intergenic
1194526369 X:94982843-94982865 TGGGAAAGTGCAGTGACTGTGGG + Intergenic
1195037259 X:100981373-100981395 AGAGAGAGTGCAGTGATTGTAGG - Intronic
1195199244 X:102532133-102532155 AGGAAGAGTGCAGCAACTGGGGG + Intergenic
1195595331 X:106682705-106682727 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1195618738 X:106932835-106932857 AGTAAGAGTTCAGTGAGTGTGGG - Intronic
1196224161 X:113146027-113146049 AGGAAGAATGGGGTGACTGGGGG - Intergenic
1196357470 X:114810559-114810581 AGGGAGAATGCAGTGACTGTGGG - Intronic
1197099676 X:122637407-122637429 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1197896255 X:131318680-131318702 AGTAAAATTTCAGTAACTGTTGG + Intronic
1197953034 X:131918400-131918422 AGGGAGAGTGCAGCAACTGTGGG + Intergenic
1197971883 X:132122966-132122988 AGGAAAATGGCAGTGACTGGAGG - Intronic
1198947674 X:142032232-142032254 AGGGAGAATGCAGTGATTGTAGG - Intergenic
1198964946 X:142217431-142217453 AGGGAGATTCCAGTGATGGTAGG + Intergenic
1199325091 X:146489933-146489955 AGGGAGAGTACAGTGACTGAGGG + Intergenic
1200179923 X:154143997-154144019 AGGAAGGTGGCGGTGACTGTGGG - Intergenic
1201179404 Y:11331812-11331834 ATGAAGAAGGCAGTGCCTGTGGG - Intergenic