ID: 1192047296

View in Genome Browser
Species Human (GRCh38)
Location X:67689320-67689342
Sequence CAGATTATTCAGAGAGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 290
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 264}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192047292_1192047296 20 Left 1192047292 X:67689277-67689299 CCATTCACACCTACTTAAGATAT 0: 1
1: 0
2: 0
3: 11
4: 129
Right 1192047296 X:67689320-67689342 CAGATTATTCAGAGAGTGGAGGG 0: 1
1: 0
2: 2
3: 23
4: 264
1192047291_1192047296 23 Left 1192047291 X:67689274-67689296 CCTCCATTCACACCTACTTAAGA 0: 1
1: 0
2: 1
3: 14
4: 266
Right 1192047296 X:67689320-67689342 CAGATTATTCAGAGAGTGGAGGG 0: 1
1: 0
2: 2
3: 23
4: 264
1192047293_1192047296 11 Left 1192047293 X:67689286-67689308 CCTACTTAAGATATCTGTCTAAA 0: 1
1: 0
2: 1
3: 16
4: 233
Right 1192047296 X:67689320-67689342 CAGATTATTCAGAGAGTGGAGGG 0: 1
1: 0
2: 2
3: 23
4: 264

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192047296 Original CRISPR CAGATTATTCAGAGAGTGGA GGG Intronic
902774717 1:18667331-18667353 CCGCATCTTCAGAGAGTGGAAGG + Intronic
903469505 1:23575991-23576013 CAGGTTATACTGAGAGTGGAAGG - Intergenic
906418128 1:45638807-45638829 AAAATTATTCACAGAGAGGATGG + Intronic
914918446 1:151832117-151832139 CAGATTGATCAGTGAGTGGAGGG + Intergenic
915956242 1:160222667-160222689 CAGATTATTCAGTTCATGGAGGG - Exonic
916021750 1:160798698-160798720 CAGAATATGCAGACACTGGAAGG - Intronic
917830064 1:178873212-178873234 CAGATTATTTAGTGTGTTGAAGG + Intronic
919340711 1:196302916-196302938 CAAATTATTCAGGGATAGGAAGG - Intronic
919464303 1:197911885-197911907 CTGATTATTGAGAGGCTGGAAGG + Intronic
922007472 1:221546324-221546346 CAGAGACTTCAGAGAGTGCATGG + Intergenic
922301205 1:224302551-224302573 CAGATTTTTCAGAAACTGTAGGG - Intronic
924439266 1:244073032-244073054 AAGATTCTTCAGAAAGTGGCAGG + Intergenic
1062988039 10:1788438-1788460 CAGATTTTTCCGAGAGTTCACGG - Intergenic
1063998860 10:11646159-11646181 CACTTTATTCACATAGTGGAAGG + Intergenic
1064118498 10:12599271-12599293 CATCTTATTTTGAGAGTGGAAGG + Intronic
1064515601 10:16144410-16144432 AAGATAAATCAGAGAGTGAAAGG - Intergenic
1064839297 10:19572878-19572900 CAGAGTCTTCAGAGAGAGCAGGG + Intronic
1066746560 10:38607574-38607596 CAGCTTCTTCAGGGAGTAGAGGG + Intergenic
1068008094 10:51413711-51413733 CACATTATTAAGAGATTGAATGG + Intronic
1068341586 10:55711307-55711329 CAAATTATTCAGAAATAGGAGGG - Intergenic
1072306568 10:94113478-94113500 CTGAGTGTTCAGAGGGTGGATGG + Intronic
1072402685 10:95121860-95121882 CAGATTCTTCAGAGCTAGGAGGG + Intergenic
1074070905 10:110068293-110068315 CAGAAGATTCAGAGAAAGGAGGG - Intronic
1075242383 10:120790969-120790991 GGGATTCTTCAGAAAGTGGAGGG - Intergenic
1075481266 10:122783958-122783980 CAGAGTAATGAGAGACTGGAAGG - Intergenic
1075688718 10:124381047-124381069 CAGATGAGTCAGAGTGTGGGAGG - Intergenic
1077404345 11:2376480-2376502 CTAATGATTCAGAGAGTGAAGGG - Intronic
1078470502 11:11582260-11582282 GAGAGGCTTCAGAGAGTGGAGGG + Intronic
1079025118 11:16940972-16940994 TCGTTTATCCAGAGAGTGGAGGG - Intronic
1079455168 11:20630183-20630205 CAGAATATTCAGTGTCTGGAGGG + Intronic
1080580315 11:33637065-33637087 CAGAAAATTCAGCAAGTGGAAGG + Intronic
1080878714 11:36299708-36299730 GAGATTATTCAGCGAGTGGCGGG + Intronic
1082753856 11:57052345-57052367 CAGATGATTAAAAGAATGGATGG + Intergenic
1083085856 11:60144395-60144417 CATATTATCCAGATAGTGTATGG + Intergenic
1085331476 11:75655527-75655549 CAGATTGGTCAGATAATGGAAGG + Intronic
1086312081 11:85547082-85547104 CAGTTTATTCATAGCGTCGATGG + Intronic
1086591484 11:88520407-88520429 CTGAGTATTCAGAAAGTGTAAGG - Intronic
1088115858 11:106312143-106312165 CAGATCATTCTGAGTGTGCAAGG + Intergenic
1089282260 11:117382621-117382643 CAAATAATTCAGGGAGAGGAAGG + Intronic
1089312229 11:117566230-117566252 CAATTTATGCAGAGGGTGGAGGG - Intronic
1089559842 11:119338269-119338291 CACATTAAACAGAGACTGGAAGG - Intergenic
1090412634 11:126519667-126519689 CAGATTCTTCTGAGGATGGAGGG + Intronic
1090689079 11:129158138-129158160 CAGTTTATTCATAGTGTTGATGG - Intronic
1090819693 11:130330393-130330415 CAGTTTCTTCAGAGTTTGGAGGG + Intergenic
1093009002 12:14084263-14084285 CAGATTTGTCAAAGATTGGATGG - Intergenic
1093140615 12:15506564-15506586 CACCTTATTCAGAGGGTGGCAGG + Intronic
1094448347 12:30557920-30557942 CAAATAATTCAGTGAGTGGCTGG - Intergenic
1094755614 12:33464779-33464801 CAGTTTCTTCAGAGAGACGATGG - Intergenic
1095440561 12:42235556-42235578 AAGAGAATTCAGAGAGAGGAAGG + Intronic
1098107202 12:67081645-67081667 CAGATTATGCAAAGCCTGGATGG + Intergenic
1098736608 12:74112889-74112911 CTGATTATTCAGAGTCTGAAGGG + Intergenic
1098777083 12:74634430-74634452 CATAGAATTCAGAGACTGGATGG - Intergenic
1099071611 12:78051268-78051290 GAGGTTATTCAGAGTGTTGAAGG + Intronic
1099344345 12:81479503-81479525 CAGTTTCTTCATAGAGTCGATGG + Intronic
1100186999 12:92149496-92149518 CAGATTGTTTGGAGAGTGGGAGG + Intergenic
1100593468 12:96051565-96051587 GAGATTATTAAGAGTGTGGCTGG + Intergenic
1100684126 12:96967012-96967034 AGGATTATTCAAAGAGTGCAAGG - Intergenic
1101045019 12:100795685-100795707 CAGGCTCTTCAGAGAGTGGTAGG + Intronic
1101296352 12:103427021-103427043 CAGTTTCTTCAGAGTGTTGATGG - Intronic
1102133856 12:110556099-110556121 CAGATTATTTAGTGAGTGCGAGG - Intronic
1104888923 12:132130217-132130239 GAAAATATTCAAAGAGTGGATGG + Intronic
1106562227 13:30856829-30856851 CAGATTTTTACAAGAGTGGATGG - Intergenic
1106828800 13:33555608-33555630 TAGATTTTTGAGAGAATGGATGG + Intergenic
1106906033 13:34409656-34409678 GAGATTATACAGAGTGTGGTGGG - Intergenic
1107569439 13:41641384-41641406 CAAAATATTTAGAGAGTTGATGG + Intronic
1109117763 13:58410202-58410224 CAGTATCTTCACAGAGTGGAAGG - Intergenic
1109399942 13:61813302-61813324 CAGATTATGCAGATAGAGGTGGG + Intergenic
1109802232 13:67395466-67395488 CAGATTATTCAAATAGAGAAAGG - Intergenic
1112852379 13:103722675-103722697 CAGTTTAATCAGAGAGTGCCAGG - Intergenic
1117549573 14:56820618-56820640 CAAATTATTCAGAAGGTTGAGGG + Intergenic
1118323070 14:64764638-64764660 CAGATGACACAGACAGTGGATGG + Intronic
1119858565 14:77920034-77920056 CAGACAATCCACAGAGTGGAAGG - Intronic
1119964940 14:78904105-78904127 AAGATTATTCAGATAGTAAAAGG + Intronic
1120499054 14:85271288-85271310 TAGCTTATTCTGAGAATGGAGGG - Intergenic
1121603180 14:95221174-95221196 CACATTCTTCACAGAGGGGAGGG - Intronic
1122890708 14:104730942-104730964 CAGACTAGGCAGAGAGTGGGGGG + Intronic
1125354332 15:38801547-38801569 CAGTTTATTCATAGTGTTGATGG + Intergenic
1127317655 15:57813207-57813229 CAGTTTATTCATAGTGTCGATGG + Intergenic
1127969426 15:63946865-63946887 CAGATTATTCAGGCAGTGCTGGG + Intronic
1129836280 15:78709348-78709370 CAAATTCTTCGGAGAGTGAAAGG - Intronic
1130235368 15:82128316-82128338 CAGATTTTCCACAGACTGGAAGG - Intergenic
1130617341 15:85423749-85423771 CAGATTCATCAGAGGATGGATGG + Intronic
1131084678 15:89566423-89566445 CAGCTTCTCCGGAGAGTGGAAGG - Intergenic
1133237816 16:4395876-4395898 CAGATTATCCAAAGGGAGGATGG + Intronic
1133482734 16:6186839-6186861 CAGAATATGCAGAGAATGTAGGG + Intronic
1134271689 16:12738666-12738688 CAAATTATTTAGAGAGTTTATGG + Intronic
1134389160 16:13803052-13803074 CAGATGGTTCAGAGCTTGGAAGG + Intergenic
1135469069 16:22712950-22712972 CAGCTAATTCATTGAGTGGAGGG + Intergenic
1136736504 16:32472061-32472083 CAGCTTCTTCAGGGAGTGGAGGG - Intergenic
1136996868 16:35196485-35196507 CAGCTTATTCCGTGTGTGGAAGG - Intergenic
1137023537 16:35452626-35452648 CAGCTTATTCTGTGTGTGGAAGG - Intergenic
1138235772 16:55381205-55381227 AAAGTTATTCAGAAAGTGGATGG + Intergenic
1140859320 16:79005498-79005520 TAGAGTTTTCAGAGAGAGGATGG - Intronic
1203016566 16_KI270728v1_random:357517-357539 CAGCTTCTTCAGGGAGTGGAGGG + Intergenic
1203034901 16_KI270728v1_random:630675-630697 CAGCTTCTTCAGGGAGTGGAGGG + Intergenic
1142852794 17:2712196-2712218 TGGATTATTGAGGGAGTGGAGGG + Intronic
1144415558 17:15042876-15042898 CAGATTTTTCAGAGGGAGGAAGG + Intergenic
1146746112 17:35332011-35332033 CAGTTTCTTCAGAGTGTCGATGG + Intergenic
1147949331 17:44098213-44098235 CAGATCCTTGAGAGAGTGCAAGG - Intronic
1148566530 17:48636187-48636209 CAAATTATTCAGAAAATTGATGG + Intergenic
1148580189 17:48738344-48738366 CAGGTTATTGAGAGGGTGGAGGG - Intergenic
1149540833 17:57466920-57466942 TAGTTTAATGAGAGAGTGGAGGG + Intronic
1150910279 17:69380717-69380739 CAGAGCATTCAGAGAGGGAAGGG - Intergenic
1155410077 18:25534220-25534242 TAGATTATTCAGAGAATGGAGGG + Intergenic
1156188166 18:34688220-34688242 CAGTTTCTTCATAGTGTGGATGG + Intronic
1156422141 18:36966120-36966142 CAGCTTATTCAAAGAGCTGAGGG + Intronic
1156464779 18:37341908-37341930 CAGATGAGTCAGAGAGTTGTGGG - Intronic
1157043560 18:44067782-44067804 AAGCTTATTGAGAGAGTGAAGGG + Intergenic
1157498315 18:48171909-48171931 CACAGTCTTCAGAGACTGGAAGG - Intronic
1157919052 18:51697260-51697282 CAGATGATTCAGCGAGTGCCTGG - Intergenic
1158902516 18:61979099-61979121 TAGATTAGTAAGAGAGTGTACGG - Intergenic
1161743850 19:6042757-6042779 CTGATGTTTCAGAGAGGGGAGGG - Intronic
1162218742 19:9158200-9158222 AAGATTTGTCAGAGAATGGATGG - Intronic
1163251936 19:16131245-16131267 CAGATAAGTGAGAGAGTGGTTGG + Intronic
1165970188 19:39622473-39622495 CAGTTTATTCATAGTGTTGATGG + Intergenic
1167557294 19:50204203-50204225 CCCATTATACAGAGAGGGGAAGG + Intronic
1167733051 19:51273055-51273077 TAGATTCTTCTGTGAGTGGACGG - Intergenic
927337211 2:21938871-21938893 CAGATAAATCAGAGTGTGAAAGG - Intergenic
928205656 2:29281391-29281413 CAGATTGGTGAGAGAGTGGAAGG - Intronic
929062696 2:37939960-37939982 CAGTTTCTTCATAGTGTGGATGG + Intronic
929204041 2:39269636-39269658 AACATTATTCAGAGTGTGCAAGG + Intronic
929705992 2:44212468-44212490 CAAATCTTTCAGGGAGTGGAGGG - Intronic
929853683 2:45616735-45616757 CACCTTATTCACAGAGTGGCAGG + Intergenic
930921948 2:56766664-56766686 AAGATTATTCATTGAGTGAATGG - Intergenic
931976078 2:67645779-67645801 TGGATTATCCAGGGAGTGGATGG + Intergenic
932588167 2:73045134-73045156 CAGTTTTCTCAGAGAGGGGATGG - Intronic
932796471 2:74700168-74700190 CAGATAATTCACAGAGGGGGAGG + Intergenic
934187663 2:89761182-89761204 CAGCTTCTTCAGGGAGTGGAGGG - Intergenic
934308961 2:91846764-91846786 CAGCTTCTTCAGGGAGTGGAGGG + Intergenic
935230887 2:101094854-101094876 CAGACTATTCAGAGAACGAAGGG + Intronic
935809099 2:106779064-106779086 TAGATTATTAAGAGAATTGATGG - Intergenic
935961694 2:108431424-108431446 CAGTTTCTTCATAGTGTGGATGG - Intergenic
936915552 2:117636099-117636121 CACATGCTTCAGAGGGTGGAAGG - Intergenic
937486688 2:122322715-122322737 CAGATTAGTCAGGGAGGGGCTGG + Intergenic
937829277 2:126402195-126402217 CAAATTATGCAGAGGGTCGATGG + Intergenic
938294813 2:130171620-130171642 CAGATTCCCCAGAGGGTGGAGGG - Intronic
938461818 2:131502224-131502246 CAGATTCCCCAGAGGGTGGAGGG + Intergenic
939686932 2:145211905-145211927 CAGTTTCTTCAGAGTGTCGACGG + Intergenic
940558693 2:155265941-155265963 AAGGTTATTCAGAGATTGAAAGG - Intergenic
942007006 2:171713327-171713349 TAGATTATTCATAGAATGTATGG + Intronic
943713761 2:191127069-191127091 CAAATCATCCAGAGACTGGATGG - Intronic
944502177 2:200373076-200373098 CTGATTATTCAGAGGCTTGAAGG + Intronic
946081658 2:217125319-217125341 CTGTTTACTCAGAGAGAGGAAGG + Intergenic
946229721 2:218283722-218283744 GGGATAATTCAGAGAGGGGAAGG + Intronic
948742099 2:240054921-240054943 GAAATTATTTAGAGTGTGGAAGG + Intergenic
1169872897 20:10266164-10266186 CTGATGATTCAGAAAATGGAAGG + Intronic
1172441986 20:34972208-34972230 CAGATCATTCAGAGCCTTGAAGG - Intergenic
1172615566 20:36281302-36281324 CAGATGAATGGGAGAGTGGATGG - Intergenic
1178360946 21:31948253-31948275 CAGGTTAGCCAGAGAATGGATGG - Intronic
1180536044 22:16393859-16393881 CAGCTTCTTCAGGGAGTGGAGGG + Intergenic
1180880062 22:19197301-19197323 GAGGTTAGTCTGAGAGTGGAGGG - Intronic
1181379377 22:22488266-22488288 CAGATTTTACAGACAGTAGAGGG + Exonic
1182069627 22:27454517-27454539 CAGGTGATACAGAGAGTTGATGG + Intergenic
949440360 3:4073398-4073420 CAGTTTCTTCATAGAGTTGATGG - Intronic
949859982 3:8496190-8496212 CAGATTAATAAGGGAGTGGAAGG - Intergenic
951150401 3:19282816-19282838 CAGCTGATTCAGAACGTGGATGG - Intronic
951787575 3:26439324-26439346 CAGATTCTTAAAAGAGTTGAGGG + Intergenic
951919567 3:27839289-27839311 CAAATTATTGAGATCGTGGAGGG + Intergenic
952867842 3:37867349-37867371 CAGATCATTCAAAGCGTGAATGG - Intronic
953750565 3:45605450-45605472 CTGATTATTCTAAGAATGGAAGG - Intronic
954507937 3:51095238-51095260 CAGTTTCTTCATAGTGTGGATGG + Intronic
956907039 3:73777231-73777253 CAGATTATGCAGAAGGTGGTTGG + Intergenic
958496996 3:94857629-94857651 CAGATTAAACAGACAGTGTACGG - Intergenic
958883898 3:99704683-99704705 CAGATTGTTCAGAGTCTGCAGGG - Intronic
960770178 3:121185122-121185144 CAGTTTCTTCAGAGTGTCGATGG - Intronic
962130047 3:132662887-132662909 CAGATTATTTAAAGATTGAAGGG + Intronic
962191414 3:133314975-133314997 GAGATTATACAGTCAGTGGATGG - Intronic
962888574 3:139651452-139651474 GAGGTTATTCTGAGAGGGGAAGG + Intronic
963976526 3:151485864-151485886 CAGTTTCTTCATAGTGTGGATGG - Intergenic
965471018 3:169091701-169091723 CAGACTTCTCAGAGACTGGAAGG + Intronic
966999741 3:185322563-185322585 AAGATTATACAGAGTGAGGAAGG - Intronic
967233868 3:187366434-187366456 CACATAATTTACAGAGTGGAGGG + Intergenic
967452314 3:189639435-189639457 CAGATTAAGTAGAGAATGGAAGG - Intronic
968177150 3:196560664-196560686 CAGAGTTTACAGAGAGTGGGTGG + Intronic
969894692 4:10292559-10292581 CAGATGCTTCAGAGACAGGAAGG - Intergenic
970633028 4:17974890-17974912 CAGATTCTTCAGATGGTGAAAGG - Intronic
971638279 4:29093312-29093334 TTGATTATTTAGAGAGTGTAGGG + Intergenic
972582624 4:40408037-40408059 CAGATTATTCAGAATATGGAAGG - Intergenic
972939883 4:44182494-44182516 CACATGTTTCAGAGAGTGCATGG - Intronic
974166626 4:58212873-58212895 CAGATTGATCAAAGAGTGCAGGG + Intergenic
974541168 4:63238367-63238389 CAGATGCTTCAGAGAGAGCATGG - Intergenic
975196779 4:71534783-71534805 AAGATTATTCAGATAGTTCATGG + Intronic
975385162 4:73749545-73749567 CAGAGTAGACAGAGGGTGGAGGG + Intergenic
976573899 4:86646236-86646258 CATATTATTAAGAGAATGAAAGG + Intronic
976819594 4:89190433-89190455 CAGTTTATTCATAGTGTGGTTGG + Intergenic
977500460 4:97830437-97830459 CAGTTTCTTCATAGAGTTGATGG - Intronic
977667637 4:99659253-99659275 CAGACCATTCAGAGAGGAGAAGG - Intergenic
978961778 4:114688277-114688299 CAGATAATTCAGTAAGTGGAAGG - Intergenic
979137378 4:117126986-117127008 CAGCTTCTTCACAGAGTGGTTGG - Intergenic
979161735 4:117470158-117470180 CAGGTTGTTCACAAAGTGGAAGG + Intergenic
980729142 4:136804730-136804752 GAGATTATGCAGACAGTTGACGG - Intergenic
980945662 4:139318020-139318042 TATAATATTCAGAAAGTGGATGG + Intronic
982467199 4:155745803-155745825 CAGATTAATCAGAGTGCTGATGG + Intergenic
982593451 4:157347363-157347385 CAAATTATTTAGCGAGTGTATGG - Intronic
982989084 4:162247394-162247416 CAGATAATTAAGAAAGTGGGTGG - Intergenic
984033208 4:174630924-174630946 TAGATTATTCTGAAATTGGAGGG + Intergenic
985864568 5:2504326-2504348 CACATGATACAGAGGGTGGAAGG - Intergenic
987710517 5:21497146-21497168 CCCATTATTCAGAGCGTGTATGG + Intergenic
987823629 5:22998918-22998940 CAGATAATTAAGAGAGTTGGGGG + Intergenic
987889419 5:23856899-23856921 CAGTTTATTCATAGTGTTGATGG - Intergenic
988244215 5:28657393-28657415 CAGAGTATTCAGAGTTTGGTAGG - Intergenic
988448606 5:31316393-31316415 CAGATGATTCACAGAGCTGAAGG + Intronic
990791031 5:59480392-59480414 CAGACTATTCAGAGAGTACGTGG - Intronic
991699081 5:69300427-69300449 CAAATTATTCAGAGACTTTATGG + Intronic
992543182 5:77784583-77784605 CACACTAATCAGAGAGTGAAAGG - Intronic
993674707 5:90802849-90802871 CAGCTTTCTCAGAGACTGGAAGG - Exonic
994130989 5:96227112-96227134 CAGTTTATTCAGAGAGTGAGGGG + Intergenic
994835963 5:104852674-104852696 CAGTTTCTTCACAGTGTGGATGG + Intergenic
994979916 5:106860820-106860842 AAGAGTATTCAGAGAGAGAAGGG - Intergenic
995167154 5:109057439-109057461 CAGAATATTCAGATATTAGAAGG + Intronic
996288286 5:121821601-121821623 CACATCATTCAGAGAGCTGATGG + Intergenic
996762735 5:127002728-127002750 CAGAACGTTCAGAAAGTGGATGG + Intronic
999653311 5:153788445-153788467 CATTTTATTCTGAGATTGGAGGG - Intronic
1000999136 5:167988703-167988725 CAGATCATGCAGAGAGTTGAAGG + Intronic
1001934226 5:175693235-175693257 CAGAGCATTCAGAGGGTGGAAGG + Intergenic
1002574160 5:180162008-180162030 CAAATTCATCAGTGAGTGGATGG + Intronic
1002771674 6:295420-295442 CAGATTATACAGAAGATGGAGGG + Intronic
1003386733 6:5674667-5674689 CAGATTCTTGAGGGGGTGGATGG + Intronic
1003464220 6:6363020-6363042 GAGATTTATCAGAGAATGGAGGG - Intergenic
1003670642 6:8154650-8154672 CAGAAGAGGCAGAGAGTGGAAGG + Intergenic
1005144085 6:22667784-22667806 CAGATCATTCAGAGAAGGAATGG - Intergenic
1006748096 6:36359143-36359165 CAGATTAAACAGAAAGGGGATGG + Intronic
1007753748 6:44085444-44085466 CAGCTCATTCATAGAGTGGGTGG + Intergenic
1008309491 6:49949280-49949302 CAGATTGTTAAGAGAGTGGTTGG - Intergenic
1011704437 6:89986624-89986646 CAGAACATTCAGAGAGCGGGTGG - Intronic
1011922347 6:92595237-92595259 CTGATGATTCTCAGAGTGGATGG - Intergenic
1012340242 6:98112212-98112234 TAGATAATTGAGAGAGTGAACGG + Intergenic
1014329342 6:120041490-120041512 CAAATTATTCGGAGAGTAGAAGG - Intergenic
1014808549 6:125859108-125859130 CAGATTCATCACAGAGTTGATGG - Intronic
1015126477 6:129760765-129760787 CAAATTGTTCTGAGAGTGTAGGG + Intergenic
1017646798 6:156546822-156546844 GTTATTATTCAGCGAGTGGATGG + Intergenic
1017712942 6:157186202-157186224 TAGATCCTTCAGAAAGTGGAGGG + Intronic
1018110238 6:160529901-160529923 CAGTTTCTTCATAGTGTGGATGG - Intergenic
1018808221 6:167277547-167277569 CAGGTCAGGCAGAGAGTGGACGG + Intronic
1020144446 7:5631982-5632004 CAGAAGATGCAGAGAGTGGCTGG + Intronic
1022167294 7:27781207-27781229 CAGATTTTTCAGTGAATTGAAGG + Intronic
1022659791 7:32356111-32356133 CAGCTCAATCAGAAAGTGGATGG + Intergenic
1022682183 7:32559220-32559242 CAGATTCTTCAGAAAGTGACTGG + Exonic
1024094254 7:45971807-45971829 CTGATGATTCAGAGTGAGGAGGG - Intergenic
1024470015 7:49758647-49758669 CAGATTTTTCAGATATTGAAAGG + Intergenic
1027622117 7:80501271-80501293 CAAATAATTCAGAAAGGGGAAGG - Intronic
1027943362 7:84713284-84713306 TAGATTATTCACAGACTGGTAGG - Intergenic
1027977105 7:85172842-85172864 CAGATCCTTGAGTGAGTGGATGG + Intronic
1029817242 7:103108654-103108676 CAGTTTATTCATAGTGTTGATGG - Intronic
1030258148 7:107534229-107534251 CAGATTCTTCATAGTGTTGATGG - Intronic
1032012653 7:128356954-128356976 CAGAGTGGTCAGGGAGTGGAGGG + Intronic
1034142714 7:148837157-148837179 AAGATTATTCAGAGGCAGGACGG - Intronic
1035354669 7:158270015-158270037 CAGGTCAGGCAGAGAGTGGACGG - Intronic
1035794278 8:2338950-2338972 CAGATTTTTCATAGTGTTGATGG - Intergenic
1037260065 8:16999159-16999181 CAGATTAGTCTGGGAGTGAATGG - Intronic
1037552222 8:19985641-19985663 CAGATTTTTCTGAAAATGGATGG - Intergenic
1037809180 8:22076277-22076299 AAGATTGTACAGAGAGAGGAGGG + Intronic
1037867447 8:22457112-22457134 CAGAATATTGAGAGAGGGGAAGG - Intronic
1039810863 8:41047268-41047290 CAGATGATTTAGGGATTGGAGGG - Intergenic
1041728751 8:61043784-61043806 TAAATTCTTCAGAGAGTGGGAGG + Intergenic
1043587206 8:81783294-81783316 CAGATTGATAAGAGGGTGGAAGG + Intergenic
1047723765 8:127666952-127666974 AAGAGAAATCAGAGAGTGGATGG - Intergenic
1048110867 8:131466794-131466816 CAGATAATTCAGCGAATAGATGG - Intergenic
1049908135 9:238089-238111 CAGATTATTCAATGATTAGAAGG - Intronic
1051045531 9:12868875-12868897 CAGTTTCTTCAGAGTGTCGATGG + Intergenic
1052461380 9:28767906-28767928 CAGATTTTTCACAGTCTGGATGG + Intergenic
1052635026 9:31092246-31092268 AAGATCTTTCAGAGAATGGAGGG - Intergenic
1059392196 9:114006260-114006282 CAGCTTATTCAGACAGAGAAGGG + Intronic
1060137963 9:121175673-121175695 CAAGTTTTTCAGAGAGTTGAAGG - Intronic
1060774329 9:126360072-126360094 CAGCTAATTCAGAGTTTGGAGGG - Intronic
1061606287 9:131713350-131713372 CAGATTCCTCAGAGAGGGGCAGG + Intronic
1062104529 9:134746297-134746319 CAGCTCTTTCCGAGAGTGGAAGG + Intronic
1186541689 X:10407757-10407779 CTGTTTATTCAGAGAGAGAACGG - Intergenic
1188696257 X:33195311-33195333 CAGATTACTGAGAAAGTGAATGG - Intronic
1188730562 X:33640736-33640758 CAGATTTGTCAAAGATTGGATGG - Intergenic
1189236396 X:39490456-39490478 TAGAGTCTTCAGAGAGAGGATGG + Intergenic
1190020860 X:46873345-46873367 CATCTTATTCAGAGAGTTCATGG - Intronic
1190099982 X:47515182-47515204 CAGATTTGTCAGAGAATTGAGGG + Intergenic
1190158103 X:48009832-48009854 CAGATCACTCAGAGTGGGGAAGG + Intronic
1190173874 X:48132716-48132738 CAGATCACTCAGAGTGGGGAAGG + Intergenic
1190826834 X:54025508-54025530 CAGGTTCTTCAGCGAGTGAAGGG - Intronic
1191588715 X:62857634-62857656 CAGATTTGTCAAAGATTGGATGG - Intergenic
1191730747 X:64332668-64332690 CAGATTATTCAGAGAATGTAGGG - Intronic
1191994255 X:67073930-67073952 CAGGCTTTTCAGAGGGTGGAGGG + Intergenic
1192047296 X:67689320-67689342 CAGATTATTCAGAGAGTGGAGGG + Intronic
1193901003 X:87177243-87177265 CAGATTTGTCAAAGATTGGATGG - Intergenic
1193949540 X:87780478-87780500 CAGTTTCTTCATAGAGTTGATGG - Intergenic
1194624982 X:96216575-96216597 CAGTTTCTTCAGAGTGTGGATGG - Intergenic
1196318588 X:114260742-114260764 CAGAAGATGGAGAGAGTGGATGG - Intergenic
1198019393 X:132643492-132643514 CATATTTTTCATAGAGTAGATGG + Intronic
1200112209 X:153746718-153746740 CAGCTTCTTCAGGGAGTGGAGGG + Intergenic
1200335691 X:155349027-155349049 CAGAGCATTCAGTGAGTGGGCGG - Intergenic
1200350778 X:155492198-155492220 CAGAGCATTCAGTGAGTGGGCGG + Intronic
1200932177 Y:8706951-8706973 CAGGAATTTCAGAGAGTGGAAGG - Intergenic
1200961845 Y:9003101-9003123 CAGAGATTTCAGAGAGAGGAAGG + Intergenic