ID: 1192047566

View in Genome Browser
Species Human (GRCh38)
Location X:67692253-67692275
Sequence ATTCTAGTCTAGAGAATCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 141}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192047566_1192047568 -3 Left 1192047566 X:67692253-67692275 CCTTTGATTCTCTAGACTAGAAT 0: 1
1: 0
2: 0
3: 12
4: 141
Right 1192047568 X:67692273-67692295 AATTCCAAAGACCCTCAGGCTGG 0: 1
1: 0
2: 1
3: 40
4: 429
1192047566_1192047573 10 Left 1192047566 X:67692253-67692275 CCTTTGATTCTCTAGACTAGAAT 0: 1
1: 0
2: 0
3: 12
4: 141
Right 1192047573 X:67692286-67692308 CTCAGGCTGGTGATGCAAGTGGG 0: 1
1: 0
2: 2
3: 17
4: 162
1192047566_1192047567 -7 Left 1192047566 X:67692253-67692275 CCTTTGATTCTCTAGACTAGAAT 0: 1
1: 0
2: 0
3: 12
4: 141
Right 1192047567 X:67692269-67692291 CTAGAATTCCAAAGACCCTCAGG 0: 1
1: 0
2: 7
3: 21
4: 116
1192047566_1192047572 9 Left 1192047566 X:67692253-67692275 CCTTTGATTCTCTAGACTAGAAT 0: 1
1: 0
2: 0
3: 12
4: 141
Right 1192047572 X:67692285-67692307 CCTCAGGCTGGTGATGCAAGTGG 0: 1
1: 0
2: 0
3: 20
4: 345

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192047566 Original CRISPR ATTCTAGTCTAGAGAATCAA AGG (reversed) Intronic
904675323 1:32195679-32195701 TTCCAGGTCTAGAGAATCAAAGG - Exonic
908357662 1:63338347-63338369 AGTCTAGTCAAGTGAATCACTGG - Intergenic
909894213 1:81045981-81046003 CTTCAAGTCTAGAGAAACAAAGG - Intergenic
909950287 1:81711852-81711874 AACCTACTCTAGAGATTCAAAGG + Intronic
911005672 1:93219951-93219973 ATTCTTGTCTTCAGAGTCAAAGG + Intronic
912363228 1:109112372-109112394 GTTCTAGTCTAGAGGAACAAGGG - Intronic
914217369 1:145644438-145644460 ATTTTGGTTTAAAGAATCAAGGG + Intronic
914469938 1:147967123-147967145 ATTTTGGTTTAAAGAATCAAGGG + Intronic
917819400 1:178746979-178747001 ATTCTAGTATACAGAAACGATGG - Intronic
919114964 1:193270075-193270097 ATTCCTGCCTATAGAATCAAGGG + Intergenic
922711008 1:227832440-227832462 AATATAGTCTAAAAAATCAAGGG - Intronic
1064363747 10:14688929-14688951 ATTCTGGGCTAGAAAACCAAAGG + Intronic
1064771633 10:18729412-18729434 ATTCTATTTTACAGAATAAAGGG - Intergenic
1066692005 10:38038589-38038611 ATTCTAGTCAAGAAAAGCAAGGG - Intronic
1068254062 10:54485258-54485280 ATTTTACCCTAGAAAATCAAAGG + Intronic
1068631844 10:59306362-59306384 ACTGTAGTCTAGAGCATCAAAGG + Intronic
1068803046 10:61163246-61163268 ATTCTAGTTGAGAGAATTTAAGG - Intergenic
1069974609 10:72202697-72202719 TTCCTAGTCTACAAAATCAAGGG + Intronic
1070051266 10:72892235-72892257 ATTCTTGTTTACAGAACCAAAGG + Intergenic
1074171169 10:110938967-110938989 CTTTTAGTCTGGAAAATCAATGG - Intronic
1077880266 11:6343659-6343681 ATTCTGGTGTTCAGAATCAAGGG - Intergenic
1079759677 11:24312886-24312908 CTTCAAGTCTAGAGAAAGAAAGG + Intergenic
1080056754 11:27914667-27914689 ATCCTAGTCTATAAAGTCAATGG - Intergenic
1083057785 11:59839548-59839570 ATTCTGATATAGAAAATCAAAGG - Intronic
1083104864 11:60347827-60347849 ATACAAGTCTAGGGAGTCAAAGG - Intronic
1088037235 11:105332812-105332834 ATTCTTTTCTAGAGACTCTAGGG + Intergenic
1088564206 11:111150482-111150504 ATTCAAGTCAATGGAATCAAAGG - Intergenic
1090109286 11:123887225-123887247 ATTCTACTCTTAAGAATCGATGG - Intergenic
1091153761 11:133354111-133354133 ATTTAAGTCTGCAGAATCAAAGG + Intronic
1093884200 12:24440665-24440687 ATTCCAGTAGAGAGAATTAAGGG - Intergenic
1094794967 12:33961047-33961069 ATTGTAGTATAGATCATCAAAGG + Intergenic
1095106761 12:38243294-38243316 ATTGTAGTATAGATCATCAAAGG + Intergenic
1095285794 12:40408731-40408753 ATCCTAGTGTAGAAAATGAATGG - Intronic
1095558700 12:43539446-43539468 ATTATAGTCTATAAAATAAAAGG + Intronic
1101082440 12:101202199-101202221 ATTCCAGTATACAGAATCTAGGG + Exonic
1107881848 13:44839312-44839334 ATTCTAGTCTAGATAACTAGAGG + Intergenic
1109078983 13:57874013-57874035 ATCCTGGTTTAGAGAAGCAAGGG - Intergenic
1109168379 13:59064244-59064266 AGTCCTGTCTATAGAATCAAAGG - Intergenic
1109651397 13:65331448-65331470 ATTTTAGAATAGAGATTCAATGG - Intergenic
1111452863 13:88441741-88441763 ATCGGAGTCTAGAGACTCAATGG - Intergenic
1111927725 13:94481009-94481031 ATTCTAGCCTAGAGTCTCCAGGG - Intergenic
1114152594 14:20061394-20061416 ATTCTAGTTTCTTGAATCAATGG + Intergenic
1114424841 14:22612766-22612788 AGTCTAGTTTAGGGAATCAGGGG - Exonic
1116230463 14:42209055-42209077 ACACTAGACTAGAGAAGCAAGGG + Intergenic
1116976397 14:51120816-51120838 TTTATAGTCAAGAAAATCAAGGG - Intergenic
1117318772 14:54600553-54600575 ATTTTAGTCTAGAAAATTGAGGG - Intronic
1118922687 14:70164451-70164473 ATTCTGGTCTAGATATTCTAGGG - Intronic
1126773614 15:52081003-52081025 ATTCTAGTCTGGGGCAGCAAAGG + Intergenic
1130706188 15:86235381-86235403 GTTTTACTCTAGGGAATCAAAGG + Intronic
1130897762 15:88184001-88184023 ACCCTAGTCTAGAGAGGCAAGGG - Intronic
1134470495 16:14521038-14521060 AAACTAGACTAGAGAATTAAAGG - Intronic
1138616653 16:58173162-58173184 ATTTTAGTCTAGAGAAGACATGG + Intronic
1149029293 17:52065624-52065646 ATTTTACCCTAAAGAATCAAAGG - Intronic
1152398262 17:80048506-80048528 ATTCTATTCTGGGGCATCAATGG - Intronic
1155227847 18:23745430-23745452 ATTCTATTCTAGAGAGCCCAGGG - Intronic
1155860266 18:30889320-30889342 AGTCAAATCTAGAGAATCATAGG - Intergenic
1156443053 18:37211213-37211235 ATTCTAGTCTGGGAAGTCAAGGG + Intronic
1156707574 18:39901570-39901592 CTTCTCGACTATAGAATCAAAGG + Intergenic
1162847820 19:13407124-13407146 CTTCTAGTCTAGAGAAGCACAGG - Intronic
1166020083 19:40019486-40019508 ATTTTAGTATAGCTAATCAAAGG + Intergenic
925641558 2:5990273-5990295 ACTCTAGTCCAGAGAATCAGAGG - Intergenic
926652526 2:15362026-15362048 ATTATAGCTTAGAAAATCAAGGG - Intronic
926779324 2:16453167-16453189 CTTCCATTCTACAGAATCAAAGG + Intergenic
928104909 2:28463519-28463541 CTTCTGGCCTAAAGAATCAAAGG - Intronic
929297634 2:40266512-40266534 ATTCTAGTGTCCAGAAGCAATGG - Intronic
929321046 2:40543842-40543864 ATTATAGTCTAATGAAGCAATGG - Intronic
929677053 2:43945881-43945903 ATTCTAGTCCTTAGAACCAAAGG - Intronic
931775898 2:65540033-65540055 GTTCTAGTCTGGAGAAGAAAAGG - Intergenic
933019258 2:77170483-77170505 ATTGTAGTCTAGAGAAACCTGGG + Intronic
933316495 2:80721421-80721443 ATTCTAGGCTTGAAAATGAAGGG + Intergenic
935232643 2:101112419-101112441 ATTCAAGTCTATAAAATGAAAGG + Intronic
935928764 2:108100043-108100065 TTTCTAATCTAGACAATCATCGG - Intergenic
939295000 2:140250637-140250659 ATTCTAGTCTGGAACATAAAGGG - Intronic
939527055 2:143308418-143308440 ATTCTATTCTTTAAAATCAAGGG + Intronic
942080933 2:172399059-172399081 ATTTTAGTGTAGATAATGAATGG + Intergenic
945554292 2:211260432-211260454 ATTCTAGACTAAAGTTTCAATGG + Intergenic
946768713 2:223064852-223064874 ATTATAGACCAGAGAAGCAATGG + Intronic
1170391849 20:15883796-15883818 ATTCTAGTATATAAAATGAATGG + Intronic
1172266918 20:33623862-33623884 ACTCTACTCTAGAGAATTTATGG + Intronic
1173744312 20:45424942-45424964 ATTCTGGTCTAGAGAGTAATGGG + Intronic
1173823724 20:46034325-46034347 ATTCTAGGATAGAAGATCAAGGG - Intronic
1173978426 20:47204790-47204812 TCTTTAGTCTAGAGAAGCAAAGG - Intergenic
1178054176 21:28780629-28780651 ATTCTAACCTTGAGATTCAAAGG + Intergenic
1178103614 21:29296540-29296562 ATTCTAGTATTGAGAAGGAATGG - Intronic
1181110455 22:20599766-20599788 ATTCTGGTTTTGAGAGTCAAGGG + Intergenic
949654832 3:6206085-6206107 ATTCTTTCTTAGAGAATCAATGG - Intergenic
950017208 3:9762737-9762759 ATTCTAGTCCAGATACTCAAAGG - Intronic
951829264 3:26906082-26906104 AAAGTAGTCAAGAGAATCAAAGG + Intergenic
953202726 3:40791841-40791863 ATTCTACTCTAGAGTATATAAGG + Intergenic
953617129 3:44501347-44501369 TTTATATTCTAGATAATCAAAGG - Intronic
960426103 3:117509667-117509689 ATGCTAGTATAGAGAATAATGGG + Intergenic
961731157 3:128965896-128965918 ATTCAATTCTAGAGAATTTACGG - Intronic
962678769 3:137777104-137777126 AATCTAGTTTAGAAATTCAAGGG - Intergenic
966325512 3:178748956-178748978 ATTCCAGTTTAGCAAATCAATGG + Intronic
967410867 3:189165501-189165523 ATTCTAATCCAGTAAATCAAGGG + Intronic
970845595 4:20534198-20534220 ATTCTACTGCAGAGATTCAAGGG - Intronic
971069313 4:23072934-23072956 ATTCCAGTCAAGAGCGTCAAGGG + Intergenic
971173627 4:24260020-24260042 ATTTTACTCTTGAGAAACAAAGG - Intergenic
972484123 4:39526586-39526608 ATTCTAGTATAGAGAAAAGAGGG - Intronic
973152118 4:46901036-46901058 ATGCTAGGCTAGGTAATCAAAGG - Intronic
974020900 4:56691427-56691449 GTTCTAGTCTAAAGAATCACAGG - Intergenic
974251245 4:59387521-59387543 ATTTTAGACTGGAGAAACAAAGG - Intergenic
978270044 4:106877993-106878015 TTTCTACTCTGAAGAATCAAGGG - Intergenic
978505061 4:109447874-109447896 ATTCCCTTCTAGAGAATCTAAGG + Intronic
979787675 4:124736624-124736646 TTTCTAATCTAGAGAATAAAAGG - Intergenic
981086163 4:140686536-140686558 ATTATAGTCTATACCATCAAAGG + Intronic
988948350 5:36230479-36230501 ATTCTAGTAAGGAGATTCAAAGG - Intronic
991470087 5:66958786-66958808 ATTCTATTCGAGAGCATCACAGG + Intronic
991530511 5:67608897-67608919 ATTCTTGCCCAGAGAATAAATGG + Intergenic
991629119 5:68636378-68636400 TTTCTAGACTAAAGAACCAAAGG + Intergenic
992994318 5:82317538-82317560 ATTCCTGTCAATAGAATCAAAGG + Intronic
993459114 5:88161339-88161361 ATTCAACTGTAGAGATTCAAAGG + Intergenic
993909979 5:93669561-93669583 ATTCTTTAATAGAGAATCAAGGG + Intronic
994863220 5:105226409-105226431 TTTTTAGTCTAGAAAAACAAGGG + Intergenic
995316562 5:110781430-110781452 ATTCTTTTCTACAGTATCAAAGG - Intergenic
995346887 5:111131715-111131737 ATTCTACTTTATAGAATGAAGGG + Intergenic
997251530 5:132392418-132392440 ATACAAGTCTGGAGAAGCAAAGG - Exonic
1002973859 6:2053765-2053787 ATTATAGTTTAAAAAATCAAAGG - Intronic
1005386195 6:25287435-25287457 AGTCTAGTCAAGTGAAGCAATGG + Intronic
1012101797 6:95098672-95098694 GTTCTTGTCAAGAGAAACAAAGG - Intergenic
1015030059 6:128584466-128584488 AGTCTAGTCAAGTGAAGCAATGG - Intergenic
1017466761 6:154701313-154701335 ATTCAAGTCTTCAGATTCAAAGG - Intergenic
1021195985 7:17674786-17674808 ATTGTAGTCTAGAGAGGCCAGGG + Intergenic
1021267751 7:18545923-18545945 ATTTTAGTCTAGAGATTCACAGG - Intronic
1031908008 7:127482761-127482783 ACTCTATCCTAGAGAATCCAAGG + Intergenic
1033489570 7:141828947-141828969 ATTCTAGTCTACAGAAGCACTGG - Intergenic
1039256886 8:35728911-35728933 ATTCTACTTTAGAGGATCACAGG + Intronic
1039362669 8:36896906-36896928 ATTCTAGTCTATAAAAGCCAAGG + Intronic
1043460370 8:80454137-80454159 TAACTAGTCTAGAGAATTAAAGG + Intergenic
1043697951 8:83245121-83245143 ATTCTCTTCTAAAGAATAAATGG + Intergenic
1046302984 8:112322608-112322630 ATTGTAGCCAAAAGAATCAAGGG - Intronic
1047947670 8:129898139-129898161 ATTATAGGCTAAAGAACCAAGGG + Intronic
1048178975 8:132178099-132178121 ATTATAGTCTAGAGGAACACAGG + Intronic
1048778681 8:137977458-137977480 AGTCTAGTATAAAGAATGAAGGG + Intergenic
1050546237 9:6711741-6711763 TTTCTTCTCCAGAGAATCAAGGG + Intergenic
1050821209 9:9882451-9882473 ATTCTAGGCTTGAGGATGAAGGG + Intronic
1052150634 9:25110907-25110929 ATTCTAGGGAAGAGAATCACTGG + Intergenic
1055272817 9:74580932-74580954 ATTCACGTCTGGAGATTCAATGG - Intronic
1059516724 9:114902792-114902814 ATCCAAGTCTAGAAAATGAAAGG - Intronic
1061154205 9:128847265-128847287 GTTCTAGACTAGAGAAGCAGGGG + Intronic
1061957528 9:133971406-133971428 TTTCTAGGCTAGAGAGTCATTGG - Intronic
1186503002 X:10066845-10066867 AGTCTAGTCTGGAAAATGAAAGG + Intronic
1186907218 X:14124428-14124450 TTTCTAGTAAAGACAATCAAAGG + Intergenic
1190395775 X:49981237-49981259 ATTATAGTGTAGAGAAATAACGG - Intronic
1191158687 X:57303417-57303439 ATTCTTGTCAGGAAAATCAAAGG - Intronic
1191636022 X:63377790-63377812 TTTGTAATCTAGAAAATCAACGG + Intergenic
1192047566 X:67692253-67692275 ATTCTAGTCTAGAGAATCAAAGG - Intronic
1192629802 X:72768557-72768579 ATTATAGGCTATAGAAGCAAGGG + Intergenic
1192651908 X:72952247-72952269 ATTATAGGCTATAGAAGCAAGGG - Intergenic
1192882080 X:75296327-75296349 AGTCTGATCTAGAGAGTCAAAGG - Exonic
1193932617 X:87574317-87574339 ATTCTAATCTACAGAATCCAAGG + Intronic
1195313587 X:103656829-103656851 ATTCTGGCCTAGTGAATCAGTGG + Intergenic
1195648088 X:107255052-107255074 ATTCAAGTCTCTTGAATCAATGG + Intergenic
1196515153 X:116602068-116602090 AATCCATTCTAGAGAATCTAAGG + Intergenic