ID: 1192048613

View in Genome Browser
Species Human (GRCh38)
Location X:67702464-67702486
Sequence CAGGCTGCAAGGTATGATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 201}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192048613_1192048624 9 Left 1192048613 X:67702464-67702486 CCCAGATCATACCTTGCAGCCTG 0: 1
1: 0
2: 0
3: 22
4: 201
Right 1192048624 X:67702496-67702518 TGGGATGTGGGTGTTGGCAGTGG 0: 1
1: 1
2: 10
3: 67
4: 710
1192048613_1192048618 -10 Left 1192048613 X:67702464-67702486 CCCAGATCATACCTTGCAGCCTG 0: 1
1: 0
2: 0
3: 22
4: 201
Right 1192048618 X:67702477-67702499 TTGCAGCCTGTGCCTTTGGTGGG 0: 1
1: 0
2: 1
3: 26
4: 225
1192048613_1192048620 -4 Left 1192048613 X:67702464-67702486 CCCAGATCATACCTTGCAGCCTG 0: 1
1: 0
2: 0
3: 22
4: 201
Right 1192048620 X:67702483-67702505 CCTGTGCCTTTGGTGGGATGTGG 0: 1
1: 0
2: 1
3: 38
4: 558
1192048613_1192048623 3 Left 1192048613 X:67702464-67702486 CCCAGATCATACCTTGCAGCCTG 0: 1
1: 0
2: 0
3: 22
4: 201
Right 1192048623 X:67702490-67702512 CTTTGGTGGGATGTGGGTGTTGG 0: 1
1: 0
2: 1
3: 28
4: 465
1192048613_1192048621 -3 Left 1192048613 X:67702464-67702486 CCCAGATCATACCTTGCAGCCTG 0: 1
1: 0
2: 0
3: 22
4: 201
Right 1192048621 X:67702484-67702506 CTGTGCCTTTGGTGGGATGTGGG 0: 1
1: 0
2: 3
3: 22
4: 238

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192048613 Original CRISPR CAGGCTGCAAGGTATGATCT GGG (reversed) Intronic
900602130 1:3507378-3507400 GTGGCTGCAAGGGATGATGTTGG - Intronic
904089122 1:27932128-27932150 CAGCATGCAAGGCATCATCTTGG + Intergenic
906325302 1:44842022-44842044 CAGGCTCCCAGCTAGGATCTGGG + Exonic
909480380 1:76123798-76123820 CAGGCTGGAGTGCATGATCTCGG + Intronic
911444832 1:97978682-97978704 CAGGCTGCAAAAGATGAGCTGGG - Intergenic
913374421 1:118134791-118134813 CAGACAGCAAGGTATGACCAAGG - Intronic
913586486 1:120279707-120279729 CAGGCTGCTAGATAACATCTTGG + Intergenic
913621700 1:120618663-120618685 CAGGCTGCTAGATAACATCTTGG - Intergenic
914568497 1:148891569-148891591 CAGGCTGCTAGATAACATCTTGG + Intronic
914604328 1:149238682-149238704 CAGGCTGCTAGATAACATCTTGG - Intergenic
918562955 1:185891882-185891904 CAGTCTGCAGGGTATTATCCTGG - Intronic
918978589 1:191525074-191525096 CAGCCTGGAGGGCATGATCTAGG - Intergenic
919312682 1:195931085-195931107 AAGGAAGCAAGGTATGATGTTGG - Intergenic
919613826 1:199779778-199779800 CAGGCTGGATTGTGTGATCTCGG - Intergenic
922033448 1:221825974-221825996 CAGGCTCCATGGTAGCATCTAGG - Intergenic
923655886 1:235916654-235916676 CAGGCTGGAGTGCATGATCTCGG + Intergenic
1065396175 10:25240456-25240478 CAGGCTGGATGGCACGATCTAGG - Intronic
1067023296 10:42820720-42820742 CAGCCTGTAAGGTTTAATCTTGG - Intronic
1068373783 10:56152830-56152852 CAGGATGCAATTTATGTTCTTGG - Intergenic
1070325017 10:75383219-75383241 GAGGCTGCAAGGTGTGTGCTGGG - Intergenic
1071178096 10:82950857-82950879 TAAGCTACAAGGTATGACCTTGG + Intronic
1073401744 10:103263014-103263036 CAGGTTGGAATGCATGATCTTGG - Intergenic
1074395055 10:113090950-113090972 CAGGCTGGAGTGTGTGATCTTGG + Intronic
1078928854 11:15897966-15897988 CAGGCTGCAAAGTATTGGCTGGG - Intergenic
1081447241 11:43142452-43142474 CAGGCTGGAGTGCATGATCTCGG - Intergenic
1083407324 11:62467003-62467025 TAAGCTGCAAGGAATGATCTAGG - Intronic
1084534702 11:69749857-69749879 CAGGCTGTCAGATAAGATCTGGG - Intergenic
1088691748 11:112334392-112334414 AAGGCTGCAGGGCAGGATCTTGG - Intergenic
1088921678 11:114263906-114263928 CAGGCAGGAAGGCATGATATGGG - Intronic
1090643829 11:128751398-128751420 CAGGATGGATGGTATGATCATGG + Intronic
1090876025 11:130789682-130789704 CAGGCTTTATGGTATGATCCAGG + Intergenic
1091080051 11:132658095-132658117 CAGGCTGTCAGGTCTGATATAGG + Intronic
1092223662 12:6732284-6732306 CAGGCTGGAGTGCATGATCTCGG - Intergenic
1094538721 12:31345069-31345091 CAGGCTGCAAGCTCAGAACTTGG + Intergenic
1095229449 12:39721054-39721076 CAGGCTGCAAGGTGTGATGCAGG + Exonic
1095685350 12:45026931-45026953 CTGACTTCAAGATATGATCTTGG - Intronic
1095722948 12:45420972-45420994 CAGGCTGCATGGCACGATCTCGG - Intronic
1096010260 12:48207812-48207834 CAGGCTGCAGTGCACGATCTCGG + Intergenic
1097212590 12:57383655-57383677 CAGGCTGGAGTGCATGATCTCGG - Intronic
1098795616 12:74885074-74885096 CAATCTGCAAAGTATTATCTAGG + Intergenic
1100239608 12:92698185-92698207 CAGGCTGCAAGGACTGGTTTAGG - Intergenic
1100612385 12:96202246-96202268 CAAGCTGCAAGATGTGATTTGGG + Intronic
1101521442 12:105485937-105485959 CTAGCTGCAAGGTATAATCATGG - Intergenic
1102278632 12:111600886-111600908 CAGGCTGGAGTGCATGATCTCGG - Intergenic
1102291645 12:111705599-111705621 CAGGCAGCAAGCTATGAGCCTGG + Intronic
1103812486 12:123626851-123626873 CAGGCCGCAGTATATGATCTAGG - Intronic
1106609974 13:31269648-31269670 CAGGTTTCAAGGTATGAATTAGG - Intronic
1106674056 13:31938786-31938808 CAGGCTGGAGTGCATGATCTCGG + Intergenic
1107900962 13:45013241-45013263 CAGGCTGCTTGGTATGATGAAGG - Intronic
1109463924 13:62701976-62701998 CAGGCTGGATGGTGTGATCTCGG - Intergenic
1110136211 13:72070650-72070672 CAGGCAGGAAGGTAAGATCACGG + Intergenic
1110456113 13:75692030-75692052 GAAGCTGCAAGGTAAGATATTGG - Intronic
1114736679 14:25049866-25049888 CAGGCTGCACGGTAGGACCGGGG - Exonic
1114755386 14:25253930-25253952 CAGGCTGGAGTGCATGATCTCGG + Intergenic
1117684970 14:58243670-58243692 CTGAATGCAAGGTGTGATCTTGG + Intronic
1117725961 14:58674085-58674107 CCAGGTGCAAGGTAGGATCTTGG - Intergenic
1118123585 14:62873876-62873898 CATGCTCCAAGGACTGATCTGGG + Intronic
1119932079 14:78557093-78557115 CAGGCTGCAGTGCATGATCATGG + Intronic
1120089294 14:80312524-80312546 CAGGCTGGAGGGCACGATCTTGG + Intronic
1120892330 14:89502115-89502137 CAGGCTGGAATGTGGGATCTAGG - Intronic
1121240961 14:92429862-92429884 CAGGCTTCAAGGCTTGATGTGGG + Intronic
1122183145 14:99970579-99970601 CAGGCTGGAATGCAAGATCTCGG + Intergenic
1122517887 14:102321186-102321208 AAGGCTGCAAGGTGCCATCTGGG + Intronic
1122594631 14:102881040-102881062 CAGGCTGGAGTGCATGATCTTGG - Intronic
1123424450 15:20157902-20157924 CAGCCTGTAAGGTTTAATCTCGG - Intergenic
1123429081 15:20199400-20199422 CACTCTGCAGGGTATGATCCAGG - Intergenic
1123533674 15:21164433-21164455 CAGCCTGTAAGGTTTAATCTCGG - Intergenic
1125091260 15:35795556-35795578 CAGGCTGGATGGCACGATCTCGG - Intergenic
1125884898 15:43221164-43221186 GAGGCTTCAAGGTTTGTTCTAGG - Exonic
1126910408 15:53411535-53411557 AAGGCTCCAATGTATAATCTTGG - Intergenic
1130069391 15:80633906-80633928 CAGGCTGGCAGGTGTGATCTGGG - Intergenic
1133357494 16:5147307-5147329 CAGGCTGCGTGGTATCTTCTGGG + Intergenic
1134889332 16:17825004-17825026 CAGGCTGGAAGGCGTAATCTAGG - Intergenic
1136058715 16:27709952-27709974 CAGGCTGCCCGATATGAACTTGG - Intronic
1136855238 16:33650332-33650354 CACTCTGCAGGGTATGATCCAGG + Intergenic
1136860421 16:33697988-33698010 CAGCCTGTAAGGTTTAATCTCGG + Intergenic
1137600251 16:49751614-49751636 CTGGCTGCAAGGTCAGACCTGGG + Intronic
1138064618 16:53927605-53927627 GAGGATGAAAGGTATGACCTTGG + Intronic
1141345852 16:83245037-83245059 CAGCCTGCAAGGTTGGCTCTTGG - Intronic
1141861619 16:86720766-86720788 CAGAATGCCAGGCATGATCTTGG - Intergenic
1203116823 16_KI270728v1_random:1498813-1498835 CACTCTGCAGGGTATGATCCAGG + Intergenic
1203121928 16_KI270728v1_random:1546173-1546195 CAGCCTGTAAGGTTTAATCTCGG + Intergenic
1144092704 17:11872167-11872189 CAAGGTGCAATGTAGGATCTGGG - Intronic
1144554304 17:16268257-16268279 CAAGCTGCATGCTATGATATTGG + Intronic
1144757999 17:17691819-17691841 CAGGCTGGAAGGTAGCACCTGGG - Intronic
1146516408 17:33493174-33493196 CAGGCTCCAGGGTATGTGCTGGG + Intronic
1147056128 17:37836505-37836527 AAGGCAGCAAGGGATGAACTTGG - Intergenic
1147844222 17:43393600-43393622 CAGGCTGGAGGGCATGATCTTGG - Intergenic
1148225965 17:45897740-45897762 CAGGCTGGAAGGGATGATGGGGG + Intronic
1150010431 17:61497722-61497744 CATGCTGTAGGGTGTGATCTTGG + Intergenic
1157358518 18:46956990-46957012 CAGGCTGAATGGCATGATCTTGG - Intronic
1159211491 18:65327960-65327982 CAGGCTGGAGGGCATGATCATGG + Intergenic
1160575778 18:79853035-79853057 CAGGCTGCCTGGGATGCTCTCGG - Intergenic
1163422972 19:17225407-17225429 CAGGCTGGAGGGCATGATCATGG - Intergenic
1164014683 19:21242915-21242937 CAGGCTGCTGGGTCTGCTCTAGG - Intronic
1165120172 19:33553758-33553780 CAGGCTGGAAGGAAGGAGCTAGG + Intergenic
1165334224 19:35157742-35157764 CAGGCTTCAAGGGATCATCTTGG - Intronic
1165656796 19:37540220-37540242 CAGGCTGGATGGCACGATCTTGG - Exonic
1166464070 19:43016697-43016719 CAGAGCGCAAGGAATGATCTAGG + Intronic
1166731644 19:45062305-45062327 CAGACTGCATGATATGTTCTGGG + Intronic
925386736 2:3467181-3467203 CAGGCTGCAAGGGAAGCCCTCGG + Intronic
927478004 2:23428778-23428800 CATGATGCAAGGAATGATTTGGG + Intronic
927538252 2:23882244-23882266 CAGGCTGGAGTGCATGATCTTGG + Intronic
930613658 2:53571078-53571100 CAGGCTGGAATGCATGATCTCGG + Intronic
931825922 2:66000976-66000998 CAGGCTCCAAGAAATGTTCTAGG + Intergenic
932137420 2:69243393-69243415 CAGGCTGCAATGTGTGGTGTAGG + Intronic
933322002 2:80787983-80788005 CAGGCATCAATGTGTGATCTTGG + Intergenic
934693065 2:96376735-96376757 GAGGCAGCAAGCCATGATCTAGG + Intergenic
935381183 2:102452621-102452643 CAGGCTGGAATGCATGTTCTTGG + Intergenic
938399766 2:130980343-130980365 CAGGGTGGATGGCATGATCTTGG - Intronic
945741451 2:213667989-213668011 CAGGCTGGAGTGCATGATCTCGG + Intronic
947400128 2:229723644-229723666 CAGGCTGGAGTGCATGATCTTGG + Intergenic
947658963 2:231852506-231852528 TAGGCTTCATGGTATGTTCTGGG + Intergenic
948555198 2:238804789-238804811 CAGGCTGCCAGGTCACATCTGGG + Intergenic
948575265 2:238945876-238945898 CAGGCTGGAGGGTATCCTCTGGG - Intergenic
1169756769 20:9051303-9051325 CAGGCTCCAAGGGAGAATCTGGG - Intergenic
1171418856 20:25003687-25003709 AAGGCTGCAACTTATAATCTAGG + Intergenic
1173018238 20:39245915-39245937 AAGGCTGCAGGGTCTGATCTAGG + Intergenic
1175407048 20:58741670-58741692 CAGGGAGCCAGGTATGATCGTGG + Intergenic
1176950307 21:15037201-15037223 CAGGTTGCAAAGTGTGATATGGG - Intronic
1177294891 21:19161239-19161261 CAGGATGCCAGGTTTGATGTGGG - Intergenic
1178349119 21:31859146-31859168 CAAGCTGGAATGTATGATCTCGG + Intergenic
1179583548 21:42360555-42360577 CAGGCTGCAAGGGCTGGCCTAGG + Intergenic
1180734317 22:18004310-18004332 CAGGCTGGAGTGCATGATCTCGG + Intronic
1180925689 22:19552997-19553019 CAGGCTGGAGTGTGTGATCTCGG + Intergenic
1181138346 22:20785396-20785418 CTTGGTGCAAGGTATGAGCTAGG + Intronic
1184099784 22:42336020-42336042 CAGGCTGCAACCTGTGACCTTGG + Intronic
1185183891 22:49381033-49381055 CAGGCTCCAAGGTCTGAGCTTGG + Intergenic
1185261501 22:49867552-49867574 CAGGGTCCAAGGTCCGATCTGGG - Intronic
1185293759 22:50042359-50042381 CAGGCTGGATGGCAAGATCTTGG + Intronic
950114665 3:10443061-10443083 CAGGGTGCTAGGCATGAGCTGGG - Intronic
953860839 3:46542959-46542981 CAGGCTGCCAGGTGTGACTTTGG + Intronic
954153822 3:48673821-48673843 CAGGCTTCCCTGTATGATCTTGG - Intergenic
954572868 3:51656792-51656814 CAGGCTGGAGTGCATGATCTTGG + Intronic
955754778 3:62216165-62216187 CAGGCTGGAGTGCATGATCTCGG - Intronic
955929082 3:64037665-64037687 CAGGCTGGAGTGCATGATCTCGG + Intergenic
956029584 3:65023212-65023234 CAGGGTGCAAGGTAGGTTCCTGG + Intergenic
956894577 3:73646876-73646898 AAGGATGCAAAGTATGATCCTGG + Intergenic
958166491 3:89884022-89884044 CACTCTGCAGGGTATTATCTAGG - Intergenic
959607635 3:108259112-108259134 CAGTCTGCAGGGTATTATCCAGG + Intergenic
960555755 3:119028548-119028570 CATGTTGTAAGGAATGATCTTGG - Intronic
963033504 3:141003682-141003704 CAGGTTGCAAGGTGTCACCTGGG + Intergenic
968158463 3:196403761-196403783 GAGGCTAACAGGTATGATCTTGG + Intronic
968571769 4:1346054-1346076 CTGGCTGCAAGCTAGGAGCTGGG + Intergenic
970074482 4:12201991-12202013 CAGGCTGGAGTGTGTGATCTTGG + Intergenic
973953298 4:56038967-56038989 CAGACTGCAATGTAGGATCTAGG + Intergenic
977724311 4:100277170-100277192 GAGGCTGGAAGGCATGAACTTGG + Intergenic
980060999 4:128129302-128129324 CAGGCTGCAGTGTGTGACCTCGG - Intronic
983631540 4:169854299-169854321 CAGGTTGCAAGCTTTGTTCTGGG + Intergenic
986252343 5:6071992-6072014 CAGGCGGCAGGGCTTGATCTGGG - Intergenic
986325706 5:6672078-6672100 CAGGCTCCCATTTATGATCTTGG + Intergenic
986481865 5:8197707-8197729 AAGGCTGCAAAGTATGAGATGGG + Intergenic
987523547 5:19019055-19019077 CAGGGTGCAAGGTTTCATCTCGG + Intergenic
988021468 5:25627318-25627340 GAGGCTGGGAGGTATGAGCTGGG + Intergenic
988123582 5:26999192-26999214 CAGGCTGGAGGGCATGATCTCGG - Intronic
988992829 5:36688434-36688456 CATGCAGCAAGGTAAAATCTTGG + Intergenic
989401862 5:41016527-41016549 CAGTCTCCCAGGTGTGATCTCGG + Intronic
990965771 5:61446075-61446097 CAGGCTGAGTGGCATGATCTTGG + Intronic
991046616 5:62229842-62229864 CACTCTGCAGGGTATGATCCAGG - Intergenic
991342707 5:65628866-65628888 CAGGCTGAGTGGCATGATCTTGG + Intronic
991633869 5:68683503-68683525 CAGGATGGATGGGATGATCTTGG + Intergenic
993601004 5:89924835-89924857 CAGCCTTCAAGGTGTCATCTTGG - Intergenic
994974427 5:106783497-106783519 CTGTCTCCAAGGTATGTTCTTGG - Intergenic
996075943 5:119194281-119194303 CAAAATGCAAGGTATAATCTTGG - Intronic
996117246 5:119632761-119632783 CAGGCTGCAGGGCATCCTCTTGG - Exonic
996186306 5:120480076-120480098 CAGGCTGCATTGTATGCCCTTGG + Intronic
996631661 5:125640013-125640035 CAGGCTGCACCCTCTGATCTTGG - Intergenic
997362110 5:133301717-133301739 CAGCCTGCAAGCTATGCCCTTGG - Intronic
998351592 5:141505447-141505469 GATGCTGCAAGCCATGATCTTGG + Exonic
1000095385 5:157966894-157966916 CAGGATGCCAAGTCTGATCTGGG + Intergenic
1000861943 5:166466539-166466561 CAGGCTGAAAGGTAAGATAAAGG - Intergenic
1001963975 5:175897333-175897355 CAGAATGGAGGGTATGATCTTGG - Intergenic
1002068295 5:176663491-176663513 CAGGCTGGAGTGTATGATCTCGG - Intergenic
1002189316 5:177470509-177470531 CAGGCTGGAGGGTTTGAACTGGG - Intronic
1003144456 6:3498221-3498243 CAGCATGCAAGGTACCATCTTGG + Intergenic
1008406419 6:51122995-51123017 CACTCTGCAGGATATGATCTAGG + Intergenic
1009627897 6:66160545-66160567 CAGGCTCCATGGTAGCATCTAGG + Intergenic
1011295044 6:85817493-85817515 CAGTCTGCAGGATATTATCTAGG + Intergenic
1012251400 6:96985443-96985465 CACTCTGCAGGATATGATCTAGG - Intronic
1012670568 6:102041133-102041155 CAGGCTGCATGCTACAATCTAGG + Intronic
1013254210 6:108368012-108368034 CAGGCTACATAGTAAGATCTGGG - Intronic
1017158403 6:151342269-151342291 CAGGCTGGAAAGTACGGTCTAGG + Intronic
1020407899 7:7857351-7857373 CAGGCTGAAACACATGATCTGGG - Intronic
1020645532 7:10810475-10810497 CACTCTGCAAGGTATGATCCAGG - Intergenic
1021021380 7:15602353-15602375 CAGGCTGCTAATTATGCTCTGGG - Intergenic
1024235361 7:47393606-47393628 GAGGCTGCAAGGGATGAACCAGG + Intronic
1024952095 7:54874129-54874151 CAGGCTGGAATGCATGATCTTGG - Intergenic
1028111232 7:86944676-86944698 TATGCTGCAAGGTGAGATCTTGG + Intronic
1028263287 7:88690252-88690274 AATGCTACAAGGTATGATCAAGG + Intergenic
1029475555 7:100781689-100781711 CAGGCTGGAGTCTATGATCTCGG + Intronic
1030270427 7:107663425-107663447 CACGCTGCAAGGTAAGATGTTGG + Exonic
1032696524 7:134341369-134341391 CAGGCTGGAGTGCATGATCTTGG - Intergenic
1033572541 7:142646386-142646408 CAGGCTGCAGGGTGCGTTCTTGG - Intergenic
1036655363 8:10674103-10674125 GGGGCTGCAGGGTATGATATGGG - Intronic
1039620291 8:38991145-38991167 CCGTCTGCAAGGTAAAATCTGGG + Exonic
1041722379 8:60987877-60987899 CAGGCTGGAGGGCATGATCATGG - Intergenic
1045680363 8:104653153-104653175 AAGGCTTCAAGGTATGAATTTGG + Intronic
1046423256 8:114012033-114012055 CAGGCTGGAGTGCATGATCTTGG - Intergenic
1046799669 8:118412141-118412163 CAGGCTACCAGCTATGATCACGG - Intronic
1047267851 8:123325145-123325167 CAGGCTGGAAGGCACGATCTCGG + Intronic
1047329451 8:123873221-123873243 CAGGCAAGAAGGAATGATCTGGG - Intronic
1048820398 8:138375053-138375075 CAGGCTCCAAGACAGGATCTAGG + Intronic
1049134577 8:140884354-140884376 CAGGATGGAAAGTATCATCTAGG - Intronic
1049143884 8:140983334-140983356 CAGGCTGAAGTGCATGATCTTGG - Intronic
1050123448 9:2331996-2332018 CAGGCTGGATGGTGCGATCTCGG - Intergenic
1052885066 9:33638427-33638449 CAGGCTGCAGGGTGGGTTCTTGG - Intergenic
1054935853 9:70686868-70686890 CAGGCTGGAGTGCATGATCTTGG + Intronic
1055204260 9:73708495-73708517 CAGTCTGCACGGGATGATCATGG - Intergenic
1055315516 9:75029555-75029577 CAGGCTGGATGGCACGATCTCGG - Intergenic
1056192992 9:84203132-84203154 CAGGCTGGAGTGTGTGATCTCGG - Intergenic
1058748116 9:108011722-108011744 CAGGCTGCCAGGGATGTCCTGGG - Intergenic
1061447799 9:130651102-130651124 CAGGCTGCAAGGAATTAGGTCGG + Intergenic
1189168394 X:38884825-38884847 CAAGCTGGAATGCATGATCTTGG + Intergenic
1190725647 X:53188983-53189005 CAGCCAGCAAGGTGTGAGCTGGG - Intergenic
1192048613 X:67702464-67702486 CAGGCTGCAAGGTATGATCTGGG - Intronic
1192108563 X:68340953-68340975 CAGGCTGGAGTGTGTGATCTCGG - Intronic
1192293911 X:69827271-69827293 CAGTCTGCAAGATATTATCCAGG - Intronic
1195615843 X:106911305-106911327 CAGGATGGAAGCTATGTTCTGGG - Intronic
1195780793 X:108461643-108461665 CAGGCTGGATGGCATGATCTCGG + Intronic
1197708361 X:129649685-129649707 CAGGATGCAGGGTGTGATCTGGG - Intronic
1199918233 X:152368288-152368310 GGGGCTGGAAGGTATGGTCTGGG - Intronic
1200970936 Y:9151605-9151627 CAGGCAGCAAGTTGAGATCTTGG + Intergenic
1201739979 Y:17313190-17313212 CACTCTGCAGGGTATTATCTAGG + Intergenic
1201966394 Y:19741156-19741178 GAGGCTGCAAAGTATTTTCTAGG + Intronic