ID: 1192051824

View in Genome Browser
Species Human (GRCh38)
Location X:67731408-67731430
Sequence GAAATCCATCCATTCTAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192051824_1192051828 13 Left 1192051824 X:67731408-67731430 CCACCTTAGAATGGATGGATTTC No data
Right 1192051828 X:67731444-67731466 GAGATCAATGCTTGATGGAGAGG No data
1192051824_1192051829 18 Left 1192051824 X:67731408-67731430 CCACCTTAGAATGGATGGATTTC No data
Right 1192051829 X:67731449-67731471 CAATGCTTGATGGAGAGGAGAGG No data
1192051824_1192051826 8 Left 1192051824 X:67731408-67731430 CCACCTTAGAATGGATGGATTTC No data
Right 1192051826 X:67731439-67731461 TTCCTGAGATCAATGCTTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192051824 Original CRISPR GAAATCCATCCATTCTAAGG TGG (reversed) Intergenic
No off target data available for this crispr