ID: 1192055554

View in Genome Browser
Species Human (GRCh38)
Location X:67769624-67769646
Sequence GTGTAGGTTTCCAGGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192055554_1192055560 7 Left 1192055554 X:67769624-67769646 CCTTCTTCCCTGGAAACCTACAC No data
Right 1192055560 X:67769654-67769676 TCTTCACCAGGCAGGAGCCCTGG No data
1192055554_1192055558 -5 Left 1192055554 X:67769624-67769646 CCTTCTTCCCTGGAAACCTACAC No data
Right 1192055558 X:67769642-67769664 TACACTGCGCACTCTTCACCAGG No data
1192055554_1192055559 -1 Left 1192055554 X:67769624-67769646 CCTTCTTCCCTGGAAACCTACAC No data
Right 1192055559 X:67769646-67769668 CTGCGCACTCTTCACCAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192055554 Original CRISPR GTGTAGGTTTCCAGGGAAGA AGG (reversed) Intergenic
No off target data available for this crispr