ID: 1192058016

View in Genome Browser
Species Human (GRCh38)
Location X:67793087-67793109
Sequence GAAGAGGAGCCAGGCTTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192058016_1192058026 2 Left 1192058016 X:67793087-67793109 CCTCCCAAGCCTGGCTCCTCTTC No data
Right 1192058026 X:67793112-67793134 TGCCCTGGGGAGGGAGCATGAGG No data
1192058016_1192058029 6 Left 1192058016 X:67793087-67793109 CCTCCCAAGCCTGGCTCCTCTTC No data
Right 1192058029 X:67793116-67793138 CTGGGGAGGGAGCATGAGGAAGG No data
1192058016_1192058025 -7 Left 1192058016 X:67793087-67793109 CCTCCCAAGCCTGGCTCCTCTTC No data
Right 1192058025 X:67793103-67793125 CCTCTTCTGTGCCCTGGGGAGGG No data
1192058016_1192058023 -8 Left 1192058016 X:67793087-67793109 CCTCCCAAGCCTGGCTCCTCTTC No data
Right 1192058023 X:67793102-67793124 TCCTCTTCTGTGCCCTGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192058016 Original CRISPR GAAGAGGAGCCAGGCTTGGG AGG (reversed) Intergenic
No off target data available for this crispr