ID: 1192058018

View in Genome Browser
Species Human (GRCh38)
Location X:67793091-67793113
Sequence CACAGAAGAGGAGCCAGGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192058018_1192058026 -2 Left 1192058018 X:67793091-67793113 CCAAGCCTGGCTCCTCTTCTGTG No data
Right 1192058026 X:67793112-67793134 TGCCCTGGGGAGGGAGCATGAGG No data
1192058018_1192058029 2 Left 1192058018 X:67793091-67793113 CCAAGCCTGGCTCCTCTTCTGTG No data
Right 1192058029 X:67793116-67793138 CTGGGGAGGGAGCATGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192058018 Original CRISPR CACAGAAGAGGAGCCAGGCT TGG (reversed) Intergenic
No off target data available for this crispr