ID: 1192058024

View in Genome Browser
Species Human (GRCh38)
Location X:67793103-67793125
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192058024_1192058031 23 Left 1192058024 X:67793103-67793125 CCTCTTCTGTGCCCTGGGGAGGG No data
Right 1192058031 X:67793149-67793171 GTAATCAATACTGTTCTGCTGGG No data
1192058024_1192058029 -10 Left 1192058024 X:67793103-67793125 CCTCTTCTGTGCCCTGGGGAGGG No data
Right 1192058029 X:67793116-67793138 CTGGGGAGGGAGCATGAGGAAGG No data
1192058024_1192058030 22 Left 1192058024 X:67793103-67793125 CCTCTTCTGTGCCCTGGGGAGGG No data
Right 1192058030 X:67793148-67793170 AGTAATCAATACTGTTCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192058024 Original CRISPR CCCTCCCCAGGGCACAGAAG AGG (reversed) Intergenic
No off target data available for this crispr