ID: 1192058028

View in Genome Browser
Species Human (GRCh38)
Location X:67793115-67793137
Sequence CTTCCTCATGCTCCCTCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192058028_1192058032 19 Left 1192058028 X:67793115-67793137 CCTGGGGAGGGAGCATGAGGAAG No data
Right 1192058032 X:67793157-67793179 TACTGTTCTGCTGGGCTAGAAGG No data
1192058028_1192058030 10 Left 1192058028 X:67793115-67793137 CCTGGGGAGGGAGCATGAGGAAG No data
Right 1192058030 X:67793148-67793170 AGTAATCAATACTGTTCTGCTGG No data
1192058028_1192058031 11 Left 1192058028 X:67793115-67793137 CCTGGGGAGGGAGCATGAGGAAG No data
Right 1192058031 X:67793149-67793171 GTAATCAATACTGTTCTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192058028 Original CRISPR CTTCCTCATGCTCCCTCCCC AGG (reversed) Intergenic
No off target data available for this crispr